ID: 970166300

View in Genome Browser
Species Human (GRCh38)
Location 4:13241752-13241774
Sequence AAGAATAAATAAATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970166300_970166305 17 Left 970166300 4:13241752-13241774 CCTGGCTCCATTTATTTATTCTT No data
Right 970166305 4:13241792-13241814 TGGGACTCCCAGTGCATGCCAGG No data
970166300_970166302 -3 Left 970166300 4:13241752-13241774 CCTGGCTCCATTTATTTATTCTT No data
Right 970166302 4:13241772-13241794 CTTGTGTTTCAAACCTTTATTGG No data
970166300_970166303 -2 Left 970166300 4:13241752-13241774 CCTGGCTCCATTTATTTATTCTT No data
Right 970166303 4:13241773-13241795 TTGTGTTTCAAACCTTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970166300 Original CRISPR AAGAATAAATAAATGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr