ID: 970166685

View in Genome Browser
Species Human (GRCh38)
Location 4:13245525-13245547
Sequence TCCCCCTTACAGATAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970166685_970166691 9 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166691 4:13245557-13245579 TATGACTTGGGTGATTAAGTGGG No data
970166685_970166696 17 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166696 4:13245565-13245587 GGGTGATTAAGTGGGGGTAGGGG No data
970166685_970166697 18 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166697 4:13245566-13245588 GGTGATTAAGTGGGGGTAGGGGG No data
970166685_970166694 15 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166694 4:13245563-13245585 TTGGGTGATTAAGTGGGGGTAGG No data
970166685_970166695 16 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166695 4:13245564-13245586 TGGGTGATTAAGTGGGGGTAGGG No data
970166685_970166690 8 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166690 4:13245556-13245578 TTATGACTTGGGTGATTAAGTGG No data
970166685_970166688 -4 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166688 4:13245544-13245566 GGGAAGGAGAGGTTATGACTTGG No data
970166685_970166692 10 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166692 4:13245558-13245580 ATGACTTGGGTGATTAAGTGGGG No data
970166685_970166689 -3 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166689 4:13245545-13245567 GGAAGGAGAGGTTATGACTTGGG No data
970166685_970166693 11 Left 970166685 4:13245525-13245547 CCAGGGTTTATCTGTAAGGGGGA No data
Right 970166693 4:13245559-13245581 TGACTTGGGTGATTAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970166685 Original CRISPR TCCCCCTTACAGATAAACCC TGG (reversed) Intergenic
No off target data available for this crispr