ID: 970170473

View in Genome Browser
Species Human (GRCh38)
Location 4:13284307-13284329
Sequence CTGTAGCCACCTCAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970170473_970170479 -3 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170479 4:13284327-13284349 CAGTCATCTGGAGGCTTCAGTGG No data
970170473_970170481 11 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170481 4:13284341-13284363 CTTCAGTGGAAGCTCAGTTAGGG No data
970170473_970170483 16 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170483 4:13284346-13284368 GTGGAAGCTCAGTTAGGGATGGG No data
970170473_970170486 24 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170486 4:13284354-13284376 TCAGTTAGGGATGGGAGCTGGGG No data
970170473_970170485 23 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170485 4:13284353-13284375 CTCAGTTAGGGATGGGAGCTGGG No data
970170473_970170484 22 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170484 4:13284352-13284374 GCTCAGTTAGGGATGGGAGCTGG No data
970170473_970170480 10 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170480 4:13284340-13284362 GCTTCAGTGGAAGCTCAGTTAGG No data
970170473_970170482 15 Left 970170473 4:13284307-13284329 CCAAGCCCCTGAGGTGGCTACAG No data
Right 970170482 4:13284345-13284367 AGTGGAAGCTCAGTTAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970170473 Original CRISPR CTGTAGCCACCTCAGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr