ID: 970173804

View in Genome Browser
Species Human (GRCh38)
Location 4:13316114-13316136
Sequence TGTTAACTATAGTCACTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970173803_970173804 4 Left 970173803 4:13316087-13316109 CCTATCTAAAAATACACAATAAA No data
Right 970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970173804 Original CRISPR TGTTAACTATAGTCACTCCA AGG Intergenic
No off target data available for this crispr