ID: 970177437

View in Genome Browser
Species Human (GRCh38)
Location 4:13353608-13353630
Sequence CAGACCACACAGGTACAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970177431_970177437 14 Left 970177431 4:13353571-13353593 CCAGAACTTGTTCGTGACCCTGG No data
Right 970177437 4:13353608-13353630 CAGACCACACAGGTACAAGAAGG No data
970177434_970177437 -3 Left 970177434 4:13353588-13353610 CCCTGGGAAAATAAATGAGACAG No data
Right 970177437 4:13353608-13353630 CAGACCACACAGGTACAAGAAGG No data
970177430_970177437 30 Left 970177430 4:13353555-13353577 CCTCTCTAAAAAGCTTCCAGAAC No data
Right 970177437 4:13353608-13353630 CAGACCACACAGGTACAAGAAGG No data
970177435_970177437 -4 Left 970177435 4:13353589-13353611 CCTGGGAAAATAAATGAGACAGA No data
Right 970177437 4:13353608-13353630 CAGACCACACAGGTACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970177437 Original CRISPR CAGACCACACAGGTACAAGA AGG Intergenic