ID: 970178049

View in Genome Browser
Species Human (GRCh38)
Location 4:13359111-13359133
Sequence GACCTCATCCTGTTTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970178049_970178054 0 Left 970178049 4:13359111-13359133 CCCAAACCAAACAGGATGAGGTC No data
Right 970178054 4:13359134-13359156 CTTCTGTACTTGGTTGTGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 172
970178049_970178055 27 Left 970178049 4:13359111-13359133 CCCAAACCAAACAGGATGAGGTC No data
Right 970178055 4:13359161-13359183 ATGAGACAGCACCCACATCTTGG 0: 1
1: 0
2: 1
3: 18
4: 149
970178049_970178052 -10 Left 970178049 4:13359111-13359133 CCCAAACCAAACAGGATGAGGTC No data
Right 970178052 4:13359124-13359146 GGATGAGGTCCTTCTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970178049 Original CRISPR GACCTCATCCTGTTTGGTTT GGG (reversed) Intergenic
No off target data available for this crispr