ID: 970180170

View in Genome Browser
Species Human (GRCh38)
Location 4:13383837-13383859
Sequence CTGTCAGACCTGAATGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970180164_970180170 4 Left 970180164 4:13383810-13383832 CCACAGGAGATTTTAGCCCTAGG 0: 1
1: 4
2: 49
3: 117
4: 187
Right 970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG 0: 1
1: 0
2: 2
3: 35
4: 195
970180160_970180170 27 Left 970180160 4:13383787-13383809 CCATGTAAGGCGTGCCTGTGCTC 0: 1
1: 1
2: 112
3: 1003
4: 2317
Right 970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG 0: 1
1: 0
2: 2
3: 35
4: 195
970180163_970180170 5 Left 970180163 4:13383809-13383831 CCCACAGGAGATTTTAGCCCTAG 0: 1
1: 8
2: 49
3: 96
4: 173
Right 970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG 0: 1
1: 0
2: 2
3: 35
4: 195
970180162_970180170 13 Left 970180162 4:13383801-13383823 CCTGTGCTCCCACAGGAGATTTT 0: 1
1: 0
2: 0
3: 13
4: 186
Right 970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG 0: 1
1: 0
2: 2
3: 35
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970180170 Original CRISPR CTGTCAGACCTGAATGATGC AGG Intronic
901310458 1:8265595-8265617 CTCTAAGACCTAAAGGATGCTGG + Intergenic
905064825 1:35171517-35171539 GTATCATAGCTGAATGATGCAGG - Intergenic
907720069 1:56963652-56963674 CTCTGAGACCTGAATGAAACTGG + Intronic
911165560 1:94721380-94721402 CTGCTAGACCTGACTGTTGCAGG - Intergenic
913349517 1:117842424-117842446 CTGTCGGTCCTGAATTCTGCAGG + Intergenic
915051872 1:153083935-153083957 CTGTTGGACCTGAATTCTGCAGG + Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
916748825 1:167705522-167705544 CAGTGATACCTGAATAATGCTGG + Exonic
917895616 1:179484375-179484397 CTATCAGACCTGAACAATACAGG + Intronic
921776907 1:219111961-219111983 CTATCAGACCTGAACTCTGCAGG + Intergenic
923806803 1:237266503-237266525 CTGTCAGACCACAGTGATTCTGG + Intronic
924016276 1:239727660-239727682 CTTTCAGCACCGAATGATGCAGG + Intronic
1065536674 10:26721858-26721880 CTGTCAGAACTGAAAGAGGCAGG - Intronic
1068072046 10:52207472-52207494 CTGTCAGAACTGAAGAAAGCAGG - Intronic
1069071928 10:63998323-63998345 CTGTCAGACTTGAACTCTGCAGG + Intergenic
1069334164 10:67328409-67328431 CTGTCAGTCCTGAACTCTGCAGG - Intronic
1071284816 10:84134674-84134696 CTTTCAGACCTTTATGGTGCCGG + Intergenic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1071788762 10:88932526-88932548 CTGCCAAACCTGTATGTTGCTGG + Intronic
1072054521 10:91740976-91740998 CTGTCAGACCTGAATAGAGTGGG - Intergenic
1073467938 10:103705068-103705090 CTGTCAACCCTGAATGCTCCTGG + Intronic
1073537021 10:104286706-104286728 CTGTCAGAATTGGATGATGAAGG - Intronic
1075723474 10:124600215-124600237 CTGTCAGACCTCCAGGATCCTGG + Intronic
1076687154 10:132203331-132203353 CCGTCAGACACGGATGATGCCGG - Intronic
1080446792 11:32345022-32345044 CTGTCAAATCAGAATGTTGCTGG - Intergenic
1081083178 11:38768538-38768560 CTGTCAGACCTGAACTCTTCAGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084669736 11:70597971-70597993 CTGTCAGACTTGGTTGGTGCAGG - Intronic
1085856508 11:80181736-80181758 CTGTCAGTCCTGAACCCTGCAGG - Intergenic
1085858122 11:80198721-80198743 CTGACAGACTTGCTTGATGCAGG - Intergenic
1086462873 11:87022972-87022994 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1087377919 11:97367690-97367712 CTGTCAGACCTGATTTATACTGG + Intergenic
1087611370 11:100437982-100438004 CTGGCATATATGAATGATGCTGG - Intergenic
1088401238 11:109423767-109423789 CTGTCCCACCTGCGTGATGCAGG - Exonic
1088945057 11:114503832-114503854 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1089569196 11:119391683-119391705 GTCTCACACCTGAATGCTGCTGG + Intergenic
1090254537 11:125274235-125274257 CACCCAGACCTGAATGATGCAGG + Intronic
1091850541 12:3693411-3693433 CTGTCAGACCTGAACTCTGCAGG - Intronic
1093195821 12:16128663-16128685 CTGACAGACATGAATGTTGGAGG - Intergenic
1094044988 12:26157708-26157730 TTGTCAGAGCAGAATGAAGCAGG - Intronic
1095542791 12:43330197-43330219 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1096886238 12:54721764-54721786 CAGTCAGACCTGCCTGATTCTGG + Intergenic
1099667180 12:85646381-85646403 CTGTCATTCCTGAAAGATACAGG - Intergenic
1099732841 12:86526659-86526681 CTGTCAGACCTGAACTCTGCAGG - Intronic
1100855675 12:98755335-98755357 CTTGCAAACCTCAATGATGCTGG + Intronic
1101423354 12:104567320-104567342 CTGCCAGATCTGATTGAAGCAGG - Intronic
1101471311 12:104999530-104999552 CTATCAGACTTGAAAAATGCAGG - Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1105233042 13:18518334-18518356 CTTTCATATCAGAATGATGCTGG + Intergenic
1105396835 13:20044074-20044096 CTGTCAGATCTGAACTCTGCGGG - Intronic
1105894838 13:24709130-24709152 CTGGCAGTTCTGAAGGATGCTGG - Intronic
1106423736 13:29605956-29605978 CTGTCAGAGCTGAAAGAGACAGG + Intergenic
1108690841 13:52857751-52857773 CTCCCAGCCCTGAAGGATGCAGG - Intergenic
1113772165 13:112917235-112917257 CTGGGAGACCTGTAGGATGCGGG - Intronic
1114134664 14:19834340-19834362 CTGTCGGACATGAATTCTGCAGG + Intergenic
1114810784 14:25896540-25896562 CTGTCAGATCTCAATGACGAGGG + Intergenic
1117007119 14:51432248-51432270 TAGTCAGACCAGAATGAAGCTGG - Intergenic
1119040063 14:71265975-71265997 ATATCAGAGCTGTATGATGCAGG + Intergenic
1121514435 14:94540031-94540053 CTCTCAGAACTGGATAATGCTGG - Intergenic
1123577718 15:21689914-21689936 CTGTCAGATATGAATTCTGCAGG + Intergenic
1123614342 15:22132395-22132417 CTGTCAGATATGAATTCTGCAGG + Intergenic
1123893892 15:24809292-24809314 CTGTCGGACCTGGATGGAGCAGG + Intergenic
1123957453 15:25352583-25352605 CTGGTAGACCTGCTTGATGCAGG + Intronic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1125063865 15:35458388-35458410 CAGTGAGACCTGAATAATCCAGG + Intronic
1126506242 15:49407043-49407065 CTGTCGGACCTGAACTCTGCAGG - Intronic
1126517938 15:49556717-49556739 CTGTCAGACCTGAACAGAGCAGG - Intronic
1127188624 15:56506512-56506534 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1128105921 15:65044851-65044873 CTATCAGAGTTGAATGGTGCTGG + Intergenic
1128231275 15:66037127-66037149 CGGTCAGGCCTCAGTGATGCTGG + Intronic
1128512549 15:68322283-68322305 CTGACAGACCTGCATGCTGAAGG + Intronic
1128598970 15:68979300-68979322 ATCACAGACCTGAAAGATGCAGG - Intronic
1129578821 15:76783538-76783560 CTTTCATATCTGGATGATGCTGG - Intronic
1129706154 15:77795770-77795792 CTGCCAGACCTGGCTGAAGCAGG - Intronic
1131268206 15:90931221-90931243 CTGTCCGGCCTGAACGAGGCTGG + Exonic
1202986587 15_KI270727v1_random:424159-424181 CTGTCAGATATGAATTCTGCAGG + Intergenic
1133600580 16:7336401-7336423 CTGTCAGACCTGGATGAAATGGG - Intronic
1136104162 16:28017186-28017208 CAGTCACCCCAGAATGATGCTGG - Intronic
1138776410 16:59729233-59729255 CTGTCAGACCTGAACTGAGCAGG + Intronic
1138976528 16:62214471-62214493 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1139129528 16:64124484-64124506 CATTCATATCTGAATGATGCTGG - Intergenic
1140449290 16:75057482-75057504 CTGTAAGACCAGAATGAATCTGG - Intronic
1141071000 16:80954573-80954595 CTGTCAGACCTGAACTCTACAGG + Intergenic
1141213269 16:82000719-82000741 CTGTCAGAGTTGAATGCTTCTGG + Intronic
1142260412 16:89040100-89040122 CTGTCAGACCTGGGTGGTGGTGG + Intergenic
1146233109 17:31131086-31131108 CTGCCAGACCTGAACTCTGCAGG - Intronic
1148680412 17:49470404-49470426 CTGTCAGCCGTGATGGATGCCGG - Intronic
1148771766 17:50071496-50071518 CTGGCAGACCTGAACAATGATGG + Exonic
1149127545 17:53254295-53254317 CTGTTAGACCTGAACAATGTAGG + Intergenic
1151141120 17:71993127-71993149 CTGTCAGACCTGGATAGAGCAGG + Intergenic
1151280967 17:73073707-73073729 AAGTCAGGCCTGAGTGATGCTGG + Intronic
1156287987 18:35717969-35717991 CTGTGAGACTTGCTTGATGCTGG - Intergenic
1156725849 18:40125776-40125798 CTTTCAGACTTGAATTATGGAGG - Intergenic
1163265405 19:16217700-16217722 CTGTCAGACCTGAACTCTCCAGG - Intronic
1164583604 19:29450701-29450723 CTCTCAGACCTGAATTAGGGGGG - Intergenic
1165852939 19:38861055-38861077 CAGTTAGACCTGATTGAAGCTGG - Intergenic
926972824 2:18483997-18484019 CTGTCAGACCTGGATGGGGTGGG - Intergenic
928728762 2:34206578-34206600 CTGTCAGTCCTGAATTCTGCAGG + Intergenic
929381958 2:41364577-41364599 CTGTCAGACCTGAACTCTGCAGG + Intergenic
931557180 2:63518653-63518675 CTGTCAGACCTGAACAGTGCAGG + Intronic
932499953 2:72174457-72174479 CTGTCAGAGCTCTATGAGGCAGG + Intergenic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
935514282 2:104017191-104017213 ATGTCAGAGCTGAATGATATTGG - Intergenic
937195879 2:120156147-120156169 CTATCAGACCTGAACTCTGCAGG + Intronic
939199741 2:139018662-139018684 CTGTCAGACCTGAAATCTGCAGG - Intergenic
939859311 2:147398399-147398421 GTGTCAGACCTGAATAATAAAGG + Intergenic
943092415 2:183390451-183390473 CCGTCAGACCTGAACTCTGCAGG - Intergenic
943263832 2:185699891-185699913 CTCTCAGACATGGATGATCCTGG + Intergenic
943311880 2:186335444-186335466 CTTTCAGACCAAAATGTTGCAGG + Intergenic
943670074 2:190650087-190650109 CTGTTAAGCCTGAATGTTGCAGG + Intronic
946103791 2:217351763-217351785 CTGTCAGACCTGAACTGTGAGGG - Intronic
1172740513 20:37162825-37162847 CAGGCAAACCTGATTGATGCAGG + Intronic
1174239170 20:49119050-49119072 CTGGCAGACATGAATGAATCAGG + Intronic
1174853677 20:54021991-54022013 CTGACAGACTTGCTTGATGCAGG + Intronic
1175488532 20:59363195-59363217 ATGTCAGACCTGAATGAGCCGGG + Intergenic
1179802979 21:43820188-43820210 CTGGCAGCCCTGAATGATACGGG + Intergenic
951258771 3:20482125-20482147 CTGTCAGACCTGAATTCTGCAGG + Intergenic
952526390 3:34215027-34215049 CTGTAAGACGTGAATAATGGAGG + Intergenic
955926004 3:64005819-64005841 CTGACAGACCTGAATTACCCTGG - Intergenic
956371730 3:68570769-68570791 CTGTCAGACCTGAACTCTACAGG + Intergenic
959421542 3:106135479-106135501 CTGTCAGACCTGAACTCTGCAGG + Intergenic
959433572 3:106284933-106284955 CTGTCAGACCTGAACTTTGCAGG + Intergenic
961987995 3:131158038-131158060 CTGTCAGACTTGAACTCTGCAGG + Intronic
962393543 3:134993811-134993833 CTGTAAGATGTGAATGAAGCTGG - Intronic
962464958 3:135649410-135649432 CTGTTGGACCTGAATTCTGCAGG - Intergenic
962655787 3:137542795-137542817 CTGTTAGACCTGAACAGTGCAGG - Intergenic
963284821 3:143424118-143424140 ATGTGAAACCTGAATGATTCTGG + Intronic
963546637 3:146667935-146667957 ATGTAAGCACTGAATGATGCTGG - Intergenic
964738069 3:159936503-159936525 CTGTAAAACCAGCATGATGCTGG - Intergenic
966159444 3:176952465-176952487 CTGTCAGACTTGTATGGTACTGG + Intergenic
966714338 3:183000581-183000603 CTGACGGACCTGAATTCTGCAGG - Intergenic
970101150 4:12524232-12524254 CTGTCAGACCTGATCTCTGCAGG + Intergenic
970171042 4:13290842-13290864 CTGTCAGACATGGATGAAACAGG - Intergenic
970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG + Intronic
975655318 4:76635589-76635611 CTTTCAGACCTGATTTAGGCAGG - Intronic
977948307 4:102939559-102939581 TTTTCATATCTGAATGATGCTGG - Intronic
978596127 4:110379354-110379376 CTGTCAGACATGAACTCTGCAGG + Intronic
980869950 4:138599763-138599785 CTGACAGATCTGCTTGATGCAGG - Intergenic
981511818 4:145566208-145566230 CTGTCAGGCCTGAACTCTGCAGG + Intergenic
982629897 4:157819301-157819323 CTGTCAGACCTGATTTCTGCCGG + Intergenic
982984519 4:162189091-162189113 CTCTCAGACATGAAAGGTGCTGG + Intergenic
984199111 4:176695634-176695656 CTTTCATATCAGAATGATGCTGG - Intronic
986985288 5:13494017-13494039 CTGTCAGACCTGCACAAAGCAGG - Intergenic
987887654 5:23831883-23831905 CTGTCAGACCTGATCTTTGCAGG + Intergenic
987914949 5:24200587-24200609 CTGTCAGACCTGTACTCTGCAGG + Intergenic
989101110 5:37823914-37823936 CTGGCTGAGCTGAATGCTGCTGG - Intronic
990939880 5:61191177-61191199 CTGTCAAACCAAAATGCTGCTGG + Intergenic
991577672 5:68122134-68122156 CTGTCAGACCTGATCTCTGCAGG + Intergenic
993795913 5:92267871-92267893 CTGTCAGACCTCAATTCTGCAGG + Intergenic
993916796 5:93753958-93753980 CTGTCTGACCTGAATTGTGAGGG - Intronic
994688856 5:102991094-102991116 CTGTAAAACCTGAATAATGATGG - Intronic
994970427 5:106730499-106730521 CTGACAGATTTGAATGCTGCAGG + Intergenic
996954304 5:129164557-129164579 CTGTCAGACCTGAACTCTGCAGG - Intergenic
997440034 5:133902682-133902704 CTGTCAGACCTGGAGGCTGCAGG - Intergenic
1000413109 5:160954931-160954953 CTTTCAGAGATAAATGATGCTGG + Intergenic
1003136899 6:3440974-3440996 CTGTCAGGCTTGCCTGATGCCGG - Intronic
1005771926 6:29082415-29082437 CTGCCAGACCTGAACGGAGCAGG - Intergenic
1006574349 6:35033395-35033417 ATCTCAGACATGTATGATGCTGG + Intronic
1008687977 6:53945674-53945696 CTGTCAAACCTGAACTCTGCAGG + Intronic
1009546736 6:65030150-65030172 CTGTCAGACCTGGACAAAGCAGG + Intronic
1009877802 6:69528026-69528048 CTGTCAGATATGTTTGATGCTGG + Intergenic
1013329295 6:109082623-109082645 CTGGCATACCAGAATGATGCTGG + Intronic
1013393829 6:109713947-109713969 CTGTCGGACCTGAACTCTGCAGG - Intronic
1016453710 6:144209942-144209964 CTGTCAGACTTGAACTCTGCAGG - Intergenic
1017224811 6:152008511-152008533 CTGTCAGACCTAAATAATACTGG + Intronic
1018462720 6:164014180-164014202 CTGTCAGACCTCACTGTTGTTGG - Intergenic
1018931219 6:168241668-168241690 CTGTCAAACCTGGGTGATGGTGG - Intergenic
1018964811 6:168475995-168476017 CTGTGAGACCGGAATGGTTCTGG - Intronic
1020678237 7:11205144-11205166 CTGACACTCCTGACTGATGCTGG + Intergenic
1020708864 7:11580178-11580200 CTGTAGGTCCTGAATGAGGCAGG - Intronic
1020736080 7:11950552-11950574 CTGTCAGACCTGACCTCTGCTGG - Intergenic
1021218962 7:17952093-17952115 CTGACAGACTTGCTTGATGCAGG - Intergenic
1021581049 7:22153805-22153827 CTGTCAGATCTCAATGTTGCTGG - Intronic
1021815222 7:24440610-24440632 TTGTGAGACCTGAATGTAGCTGG - Intergenic
1021915734 7:25430580-25430602 CTATCATCCCTGAATGAGGCAGG + Intergenic
1022486826 7:30785442-30785464 CTTCCAGACCTGAATGATTAAGG - Intronic
1023193485 7:37609066-37609088 CTGACAGACCTGCTCGATGCAGG - Intergenic
1026362004 7:69610682-69610704 CTCTGAAATCTGAATGATGCGGG - Intronic
1026434213 7:70380429-70380451 CTGTCAGACGTCAATGCTGGAGG - Intronic
1027568299 7:79827535-79827557 CTGTTGGTCCTGAATTATGCAGG + Intergenic
1028660920 7:93273806-93273828 CTGACAGACTTGCTTGATGCAGG - Intronic
1032999927 7:137492756-137492778 CTGTCAGACCTGAACAGAGCAGG + Intronic
1034851244 7:154495921-154495943 CTGTCAGAGCTGAGTGCTGTGGG + Intronic
1037373644 8:18205928-18205950 CTGTCAGTCCTGAACTCTGCAGG - Intronic
1039264374 8:35808808-35808830 CTGTCAGACCTGAACTCTGCAGG + Intergenic
1040540258 8:48347503-48347525 CTGTCAGGCCTGAACTTTGCAGG + Intergenic
1040817664 8:51526147-51526169 CTGTCTGTCCTGGATGATCCAGG - Intronic
1041577903 8:59421063-59421085 CTTTCAGACCTGAACTCTGCAGG - Intergenic
1041745507 8:61204719-61204741 CTGTGAGAGCTTAATGAAGCTGG - Intronic
1042785771 8:72545345-72545367 CTGACAGACTTGCGTGATGCAGG - Intronic
1044313723 8:90726292-90726314 CTGTCAGACCTGAACTCTGCAGG + Intronic
1045398145 8:101782828-101782850 CTGTATGTCCTGCATGATGCTGG + Intronic
1046307927 8:112394985-112395007 CTGGGAGACAGGAATGATGCAGG - Intronic
1046895048 8:119463366-119463388 CTGTCAGACCTGAATTCTGTAGG + Intergenic
1047679876 8:127243638-127243660 TTGTGAGAACTGACTGATGCAGG - Intergenic
1047826893 8:128586147-128586169 CTCTTAGAAGTGAATGATGCTGG + Intergenic
1048109588 8:131453612-131453634 CTGTCAGACCTGGATAGAGCAGG + Intergenic
1048727236 8:137400491-137400513 CTGTCAGACCTGAACAGAGCAGG + Intergenic
1051607408 9:18928971-18928993 TTATCAAACCTGACTGATGCCGG + Exonic
1053488212 9:38478255-38478277 CAGTCATACTTGAATGAAGCTGG + Intergenic
1053543008 9:38993991-38994013 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1053807451 9:41817508-41817530 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1054623141 9:67369919-67369941 CTGTCAGACCTGAACTCTGCAGG + Intergenic
1057668569 9:97067531-97067553 CAGTCATACTTGAATGAAGCTGG + Intergenic
1058748167 9:108012402-108012424 CTATCAGAAATGACTGATGCAGG - Intergenic
1059142352 9:111865390-111865412 CTGTGAGAACTGATTGGTGCGGG - Intergenic
1060066428 9:120505140-120505162 CTGACAGACTTGGTTGATGCAGG - Intronic
1062214461 9:135381653-135381675 CTGTCAGATTTGAATGGGGCAGG - Intergenic
1185509126 X:649733-649755 CTGGCCGAACTGAACGATGCTGG + Intronic
1188707768 X:33356997-33357019 CTGTCAGACCTGAACTCTGTAGG + Intergenic
1188886757 X:35560650-35560672 CTGTCGGACCTGAACAAAGCAGG + Intergenic
1190524140 X:51311201-51311223 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1191137599 X:57082719-57082741 CTGTCAAACCTGAACTCTGCAGG + Intergenic
1191161170 X:57331036-57331058 CTGTCAGACCTGAAATCTGCAGG - Intronic
1193061639 X:77214003-77214025 CTGTCAGACCTGATCTCTGCAGG - Intergenic
1193492386 X:82165686-82165708 CTGCCAGACCTGAACCCTGCAGG + Intergenic
1193703355 X:84790875-84790897 CTGTCAGACCTGAACTCCGCAGG + Intergenic
1194055530 X:89127408-89127430 CTGTCAGACCTGATCTCTGCAGG - Intergenic
1194323602 X:92481636-92481658 CTGTCAGACCTGAACTCTGCAGG - Intronic
1194549114 X:95274169-95274191 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1194683689 X:96884860-96884882 CCATCAGAAGTGAATGATGCTGG + Exonic
1195289151 X:103414629-103414651 CTGTCGGACCTGAACGCTGCAGG - Intergenic
1195544614 X:106100802-106100824 CTGTCATACCTGAATGCTGCAGG - Intergenic
1195567921 X:106363699-106363721 CTGTCAAACTTGAATTCTGCAGG - Intergenic
1196122325 X:112064502-112064524 CTGTCAGAGGTGTATGAAGCTGG - Intronic
1197378818 X:125713662-125713684 ATGTCAGACCTGAACTCTGCTGG + Intergenic
1197551482 X:127897872-127897894 CTGTTGGACCTGAATGGAGCAGG + Intergenic
1197790378 X:130248578-130248600 CTGTCAGACCTGAACTCTGCAGG + Intronic
1198891674 X:141403539-141403561 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1199270151 X:145873265-145873287 TGGTCAGACCTGAATACTGCAGG - Intergenic
1199776069 X:151013091-151013113 ATGTCAGACGTGAATGCAGCTGG - Intergenic
1200631703 Y:5594798-5594820 CTGTCAGGCCTGAACTCTGCAGG - Intronic
1201177301 Y:11316616-11316638 CTGTCAGGACTGGATGCTGCAGG - Intergenic