ID: 970180174

View in Genome Browser
Species Human (GRCh38)
Location 4:13383860-13383882
Sequence GCAGTCCTGCCTATCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970180163_970180174 28 Left 970180163 4:13383809-13383831 CCCACAGGAGATTTTAGCCCTAG 0: 1
1: 8
2: 49
3: 96
4: 173
Right 970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG 0: 1
1: 0
2: 3
3: 25
4: 172
970180164_970180174 27 Left 970180164 4:13383810-13383832 CCACAGGAGATTTTAGCCCTAGG 0: 1
1: 4
2: 49
3: 117
4: 187
Right 970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG 0: 1
1: 0
2: 3
3: 25
4: 172
970180169_970180174 10 Left 970180169 4:13383827-13383849 CCTAGGGGAACTGTCAGACCTGA 0: 24
1: 32
2: 72
3: 83
4: 230
Right 970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG 0: 1
1: 0
2: 3
3: 25
4: 172
970180172_970180174 -8 Left 970180172 4:13383845-13383867 CCTGAATGATGCAGGGCAGTCCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG 0: 1
1: 0
2: 3
3: 25
4: 172
970180168_970180174 11 Left 970180168 4:13383826-13383848 CCCTAGGGGAACTGTCAGACCTG 0: 23
1: 31
2: 68
3: 94
4: 195
Right 970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG 0: 1
1: 0
2: 3
3: 25
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970180174 Original CRISPR GCAGTCCTGCCTATCACACA GGG Intronic
900646256 1:3710053-3710075 GCAGACCAGCCCATCCCACAGGG - Intronic
900917275 1:5647552-5647574 GCACTCCTGCAGCTCACACAGGG + Intergenic
901786889 1:11630502-11630524 GCACTCCAGCCTATGACATAGGG - Intergenic
902238854 1:15074986-15075008 CCTGTCCTGCCTACCTCACAGGG - Intronic
902258113 1:15204085-15204107 CCAGAACTGCCTGTCACACAAGG + Intronic
903134686 1:21301910-21301932 ACAGTGCTACCTACCACACAGGG - Intronic
903754464 1:25651292-25651314 GCCTTCCTGCCTGTCACTCAGGG - Intronic
905213104 1:36387915-36387937 GCAGATCTGCCTATCACAGAAGG + Intergenic
905874012 1:41420754-41420776 GCATTCATGCCAAACACACAGGG + Intergenic
911122194 1:94307974-94307996 GCAGTCTTGCCTAGTACCCAAGG + Intergenic
912412724 1:109489507-109489529 GCATCTCTGCCTGTCACACAAGG + Intronic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
913468890 1:119171049-119171071 GCAGTACTGCCTTAGACACAAGG - Intergenic
914820427 1:151097839-151097861 GCATTGCTTCCTATCAAACAAGG - Exonic
915123773 1:153649281-153649303 GGACTCCTGCTTATCACAAAGGG - Intergenic
916959346 1:169873128-169873150 GAATTCCTGCCCATGACACATGG - Intronic
917727120 1:177838752-177838774 TCAGTCCTGCCTAACACCCAGGG - Intergenic
920787033 1:209051450-209051472 GCAGTCTTGCATATCAGACAGGG + Intergenic
920869007 1:209777627-209777649 ACAGTCCTGCCTCTCCCTCAAGG - Intronic
921723958 1:218504234-218504256 CCAGTCCTTCCTATGACACATGG + Intergenic
921937833 1:220811010-220811032 GGAGTTCTGCGCATCACACATGG - Intronic
923855235 1:237838891-237838913 GCAGTCTTGCCCATCATAGAGGG + Intergenic
924024539 1:239818550-239818572 GTAGCCCTGCTTCTCACACAGGG + Intronic
1062948317 10:1477102-1477124 GCAGCACTGCCTCTCACTCATGG + Intronic
1064578348 10:16768667-16768689 GCAGTTCCGCCTAACACACCCGG + Intronic
1066687144 10:37992106-37992128 GCAGTTCAGCCCATCACAGAGGG + Intergenic
1069863850 10:71488104-71488126 GCAGGCCTGACTATGACCCAGGG - Intronic
1070539686 10:77407169-77407191 CCAGTCCTGCTTCCCACACATGG - Intronic
1071191682 10:83108755-83108777 GTGGTCTTGCCTATCAGACAGGG + Intergenic
1077246931 11:1544214-1544236 GAACTCCTGCTCATCACACAAGG + Intergenic
1078270825 11:9793213-9793235 ACAGCCCTGCCTATCACACAGGG - Intronic
1082034033 11:47629684-47629706 GCTGTCCTGCCTATCTCACAGGG + Intronic
1085856503 11:80181713-80181735 GCAGTCTTGCCTATCATATGAGG - Intergenic
1088674423 11:112178550-112178572 GCAGTACTGCCTAACATAGAGGG - Intronic
1090162571 11:124510726-124510748 GCAGTCTTGCCCATCAGACAGGG - Intergenic
1091440489 12:508917-508939 GCTGTCCTGCCAACCTCACAAGG - Intronic
1092073014 12:5648699-5648721 GCTGTCCTGCCTACTACACAAGG + Intronic
1092156880 12:6288734-6288756 CCATTCCTGGCTAACACACAGGG - Intergenic
1097091985 12:56513620-56513642 TCAGTCCTGCTTATCTCTCAGGG - Intergenic
1099526698 12:83725783-83725805 GCAGTAGTGCCCCTCACACAGGG - Intergenic
1100600397 12:96107733-96107755 GCAGTCCTGCCTTTAACTCCCGG - Intergenic
1101471309 12:104999507-104999529 GCAGTCTTGCCTATGAGACCTGG - Intronic
1101600381 12:106204562-106204584 GCAGCCCTGCATACCACAAAGGG + Intergenic
1106323160 13:28660939-28660961 CCAGCCCAGCCTATCACACATGG - Intronic
1109326184 13:60870243-60870265 GCAGTCTTGCCCATCAGACCTGG - Intergenic
1113129967 13:107024743-107024765 ACAATCATGCCTACCACACAGGG - Intergenic
1113581973 13:111436460-111436482 GCACTCCTGCCCATCCCACTTGG + Intergenic
1113903264 13:113807790-113807812 GCGGTCCTCCCTATCACAGGAGG + Intronic
1116336626 14:43665673-43665695 GCAGTCTTGCCCATCAGATAGGG + Intergenic
1118478514 14:66141316-66141338 GCAGTCTTGCCCATCAGACTGGG + Intergenic
1118846158 14:69549275-69549297 GCAGTCCAGCCCATCACAGAAGG + Intergenic
1119488351 14:75007767-75007789 GAAGTCCTGCCATTCACAGAAGG + Exonic
1122804569 14:104250042-104250064 TCTGTCCTGCCAGTCACACAGGG - Intergenic
1125311044 15:38378435-38378457 GAAGTCAGGCCTATCACACACGG - Intergenic
1129786123 15:78311283-78311305 GCAGTCCTGCCTTTCCCACCTGG - Intergenic
1130893131 15:88150214-88150236 GCAGCCCTGCCCATCTCAGAGGG + Intronic
1131055468 15:89372011-89372033 GCAGTGCTGCCCATCGCAGAGGG + Intergenic
1131403022 15:92141721-92141743 GCAGTTCTTCCTACCACACTCGG + Intronic
1132768382 16:1546715-1546737 GCAGCTCTGGCTTTCACACAGGG + Intronic
1134615453 16:15647996-15648018 GCACTCCAGCCTATGTCACAGGG + Intronic
1137290538 16:47049326-47049348 GCAGTCCTGCCCAGAACACAGGG - Intergenic
1138289182 16:55832504-55832526 GCAGTGCTGCCTACCTCACTGGG - Intronic
1139372122 16:66475460-66475482 GCAGGTGTGCCTGTCACACAGGG - Intronic
1141616637 16:85213625-85213647 GCCTTGCTGACTATCACACACGG - Intergenic
1141818011 16:86426062-86426084 GCACTCCTGGCTAGCACCCAAGG + Intergenic
1142204075 16:88774465-88774487 GCTGTCCTGGCTATCACAGCTGG - Intronic
1143586872 17:7854852-7854874 GCAGTCCTCCCCATCAATCACGG - Intergenic
1147771593 17:42872024-42872046 GCAGTCCTGGCAATGCCACAGGG + Intergenic
1148886383 17:50776153-50776175 GCAGTGCCGCCTATATCACAAGG - Intergenic
1152668019 17:81582786-81582808 GACCTCCTGCCCATCACACAGGG - Intronic
1153524555 18:5982213-5982235 GCACTCCTGCTTCCCACACAGGG + Intronic
1154007182 18:10541789-10541811 GCAGTCTGGACTTTCACACAGGG - Intronic
1156803254 18:41144596-41144618 ACAGTCCTGCCTTTCCCACATGG + Intergenic
1159012938 18:63075299-63075321 CCAGGCCTGCCAATCAGACACGG - Intergenic
1161655029 19:5509051-5509073 GGAGTCCTGCCCGTCACAGAAGG - Intergenic
1162472910 19:10883101-10883123 GCGGTCCTGATTAGCACACATGG + Intronic
1164673427 19:30086374-30086396 GTTGTCCTGGCTATCACTCATGG + Intergenic
1165329989 19:35136128-35136150 GCAGTACTGCCCATCTCACAGGG - Intronic
925060694 2:887805-887827 GCTGTCCTCCCTTTCACAGAAGG + Intergenic
927173314 2:20388401-20388423 GCTGCCCTGCCTACCTCACAAGG + Intergenic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
927786324 2:25977707-25977729 CCAGTCCTGCCTATTTCCCAGGG - Intronic
927786419 2:25978199-25978221 GCTCTGCTGCCTATCACCCAGGG + Intronic
928483447 2:31706704-31706726 GGAGTCCTGCCTAGCGCAGAAGG + Intergenic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
929407944 2:41664636-41664658 CCTGTCCTTCCTATCAAACAAGG + Intergenic
931489245 2:62726036-62726058 GCAGTCTTGCCCATCAGACAAGG - Intronic
933100584 2:78251710-78251732 CCAGTGCTGCCTATCTCAAATGG + Intergenic
935711364 2:105901996-105902018 GCTGTCTTGCCCATCAGACAGGG - Intergenic
937979859 2:127608632-127608654 CCAGCCCTGCCTACCCCACAGGG - Intronic
938069578 2:128301243-128301265 GCAGCCCTGCCTCACACAGAGGG - Intronic
942026269 2:171913606-171913628 GTAGGCCTGCTTATCACAGAAGG - Intronic
942343417 2:174974985-174975007 GCAATCTTGCCTAACAGACAAGG + Intronic
946326765 2:218988656-218988678 ACTGTCCTGCCTGTCTCACAGGG - Intergenic
946526074 2:220521752-220521774 GAAGTCCTGCCTGGAACACATGG - Intergenic
948312815 2:237001789-237001811 ACAGTTCTGCCTATGACACATGG - Intergenic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1172579057 20:36032263-36032285 CCGGTCCTGCCCTTCACACATGG - Intergenic
1173165574 20:40684936-40684958 GGAGTCCTGTCTATAACTCAGGG - Intergenic
1174408939 20:50321330-50321352 GCAGCCCTGCCCTGCACACACGG + Intergenic
1175350603 20:58315384-58315406 CCAGTCCTGCATACCTCACACGG + Intronic
1175541846 20:59752816-59752838 GCAGCCTTGCCTGTCACATAGGG + Intronic
1176411268 21:6450739-6450761 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1176411281 21:6450788-6450810 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1176411294 21:6450838-6450860 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1178347702 21:31845787-31845809 GCTATGCTGCCTAACACACAAGG - Intergenic
1179179606 21:39034447-39034469 GCAGCCCTGGCTGTCACACCTGG - Intergenic
1179686761 21:43059061-43059083 GCTCTCCTGCCTGTCACACTGGG + Intronic
1179686774 21:43059110-43059132 GCTCTCCTGCCTGTCACACTGGG + Intronic
1179686787 21:43059160-43059182 GCTCTCCTGCCTGTCACACTGGG + Intronic
1181479305 22:23188001-23188023 CCAGTCCAGCCCATCACCCAAGG - Intronic
1182158365 22:28097249-28097271 GTTGTCCTGCCTATCGCAAAGGG + Intronic
1184543666 22:45150157-45150179 ACAGTTCAGCCTATAACACATGG - Intergenic
1184686614 22:46099208-46099230 CCAGTCCTGCCCAACCCACATGG - Intronic
1184783268 22:46659536-46659558 GGAGTCCTGACAATGACACACGG - Intronic
954153458 3:48671473-48671495 ACAGTCCTGCCGTTCCCACAGGG + Intergenic
959041087 3:101424077-101424099 GTTGTCTTGCCTATCAAACAAGG + Intronic
959295614 3:104530990-104531012 GCAGTCTTGCCCATCAGACAGGG + Intergenic
960711262 3:120530847-120530869 GCAGTCCATCCTTTCCCACAGGG + Intergenic
961579871 3:127871961-127871983 GAAGTTCTGCCTGTCACCCATGG + Intergenic
962115673 3:132504275-132504297 GAGCTCCTGCCTTTCACACATGG - Intronic
962713438 3:138106967-138106989 CCAGCCCTGCCTACCTCACAGGG + Intronic
964062210 3:152537998-152538020 GCGGTCTTGCCCATCAGACAGGG - Intergenic
964551388 3:157888670-157888692 AGGGTCCTGCCTAACACACAGGG + Intergenic
965132057 3:164713636-164713658 AGATTTCTGCCTATCACACACGG + Intergenic
966798893 3:183743923-183743945 GCAGTCCCACCTATCACCAATGG - Intronic
968141157 3:196258249-196258271 GCACTCCAGCCTAGCCCACAGGG + Intronic
970101154 4:12524255-12524277 GCAGTCTTGCCCATCAGACAGGG + Intergenic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
975403649 4:73965406-73965428 GCAGTCTTGCCCATCAGATAGGG - Intergenic
980425927 4:132628070-132628092 CTAGTCCTGCCTTTGACACATGG - Intergenic
981165896 4:141556422-141556444 TCAGCCCTGGCTATGACACAGGG + Intergenic
982229203 4:153193088-153193110 GCATGCCTGCCTACCACAGAGGG + Intronic
984144519 4:176044555-176044577 GCAGTCTTGCCCATCAGACCTGG - Intergenic
985967909 5:3351712-3351734 GCCGCCCTGCTTTTCACACATGG - Intergenic
986892015 5:12320585-12320607 GCAGTCTTGCCCATCAGACAGGG - Intergenic
987331085 5:16858657-16858679 GCAGTTCTACGTAACACACAGGG + Intronic
989036937 5:37184133-37184155 TCAGTCTTGCTTATTACACATGG - Intronic
990221068 5:53589369-53589391 GCATTCCTGACTGTCCCACAAGG - Intronic
992654941 5:78900058-78900080 GCAGTGCTGCCTGTCCCAAATGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995421180 5:111968774-111968796 GCAGTACTACATATCACACTTGG + Intronic
995495916 5:112742994-112743016 GCAGTCCTGGAGATCAGACACGG + Intronic
995540997 5:113186211-113186233 TCAGCCCTGCTTCTCACACAGGG + Intronic
997111309 5:131077977-131077999 GCAGTCCTACCTATAGCAGAGGG - Intergenic
998618212 5:143764602-143764624 CCAGTCCTGCCCTTGACACATGG + Intergenic
998755998 5:145379933-145379955 GTAGTCTTGCCCATCAGACATGG - Intergenic
998926212 5:147128997-147129019 CCAGTCCTGCCCTTGACACATGG + Intergenic
999762554 5:154713724-154713746 GCAGTGCTGCCTCACACACAGGG + Intronic
1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG + Intronic
1001661863 5:173399523-173399545 GCAAACCTGCCTACCACACTTGG + Intergenic
1001929068 5:175659775-175659797 GCAGTCCTTCCTATGACACATGG - Intronic
1006464361 6:34182914-34182936 GCAGTCATGCTTCCCACACATGG - Intergenic
1009487080 6:64238247-64238269 CCAGTCCTGCCTAACACCCAAGG - Intronic
1009762184 6:68021786-68021808 GCAGTAGTGCCTATCAAGCATGG - Intergenic
1010329776 6:74609501-74609523 TCAGTCCAGCCTTTCACTCAAGG + Intergenic
1011290598 6:85772787-85772809 GCAGTCTTGCCTGTCAGACTGGG - Intergenic
1014130820 6:117829992-117830014 GCAGCACTGCCTATCCCAGATGG - Intergenic
1015110762 6:129589062-129589084 GCAGCCCTTCCCATCACAGAGGG - Intronic
1018933044 6:168254704-168254726 GCAGCCCAGCCCATCCCACAAGG - Intergenic
1019165779 6:170096773-170096795 TCAGTCCTGCCTTTCTCCCAGGG + Intergenic
1019992921 7:4704638-4704660 TCAGCCTTGCCTAGCACACAGGG - Intronic
1020339552 7:7095080-7095102 CGAGTCCTGCCTAGCATACACGG + Intergenic
1020366387 7:7385051-7385073 GCAGTCCTGCATATCACTCTGGG - Intronic
1021419214 7:20426098-20426120 GTGGTCCTTCCTATGACACATGG - Intergenic
1024672750 7:51611368-51611390 GCAGTCCTGCCTTTCATGCAGGG - Intergenic
1025144205 7:56490901-56490923 TCAGACCTGCCTCTCACACCTGG + Intergenic
1025259820 7:57411382-57411404 TCAGACCTGCCTCTCACACCTGG + Intergenic
1028155490 7:87424446-87424468 ACAGTCCTGCCTCTCTAACAGGG + Intronic
1029114077 7:98228528-98228550 TCATTCCTGCCTCACACACAGGG + Intronic
1031167854 7:118251991-118252013 ACAATTCTGCCTATCACACAGGG - Intergenic
1034266061 7:149781192-149781214 TCAGTCCTGTCTCTCACAGATGG + Intergenic
1034935558 7:155198313-155198335 GTAGTCATGCCTGTCACTCAAGG - Exonic
1035315528 7:157995441-157995463 CCAGGCCTGCCTGTCACTCAGGG + Intronic
1041736146 8:61113101-61113123 GCAGTTCTGCTTCTCACATAGGG - Intronic
1042483577 8:69328827-69328849 ACAGTCCTGACTTTCCCACACGG + Intergenic
1042854477 8:73252703-73252725 CCAGTTATGCCTAGCACACAAGG - Intronic
1043487155 8:80709630-80709652 CCAATCCTGCCTTTCTCACAGGG - Intronic
1043674711 8:82936908-82936930 GTAGTCTTGCCTATAAGACAGGG + Intergenic
1047814789 8:128451721-128451743 GCTATCCTTCCTGTCACACAGGG + Intergenic
1048189853 8:132277998-132278020 GAATTCCTGCCTATCACAGAAGG - Intronic
1048236696 8:132698001-132698023 GCTTCCCTGCCTATCTCACAGGG - Intronic
1049578255 8:143399377-143399399 CCCCTCCTGCCTTTCACACAGGG + Intergenic
1051253663 9:15189215-15189237 GTAGACCTGCATGTCACACAGGG + Intronic
1053530760 9:38878916-38878938 GCAGTCTTGCCCATCAGACTAGG + Intergenic
1054202983 9:62103349-62103371 GCAGTCTTGCCCATCAGACTAGG + Intergenic
1054635380 9:67485016-67485038 GCAGTCTTGCCCATCAGACTAGG - Intergenic
1057815192 9:98289249-98289271 CCTGTCCTGCCTACCTCACAAGG - Exonic
1058573278 9:106371285-106371307 CCAGTCCTGCCCTTAACACATGG + Intergenic
1059677185 9:116550719-116550741 GAATTCCTGCCTATCTCTCAGGG - Intronic
1059751610 9:117253138-117253160 GCAGTCATGCCTCTCAGTCATGG - Intronic
1059757456 9:117306937-117306959 GCAGGTGTGCCTATCACAGAGGG + Intronic
1059868547 9:118545274-118545296 GCAGTCTTGCCCATGAGACATGG + Intergenic
1060393636 9:123300406-123300428 TCTTTCCTGCCTATCCCACAGGG - Intergenic
1060667323 9:125439631-125439653 GCAGCCCCGCCCTTCACACAGGG - Intronic
1061766116 9:132882493-132882515 GCACTCCAGCCTAGGACACAGGG - Intronic
1188533053 X:31163681-31163703 GCAGTCCTTCCTCTCATTCAAGG + Intronic
1188869129 X:35352452-35352474 GCTGTCCTGCCTATAAAACTGGG + Intergenic
1195361100 X:104084580-104084602 GCAGTCTTGCACATCAGACAGGG - Intergenic
1195567918 X:106363676-106363698 GCAGTCTTGCCCCTCAGACAGGG - Intergenic
1197482514 X:127004798-127004820 TCGGTCTTGCCTATCAGACAGGG + Intergenic