ID: 970180928

View in Genome Browser
Species Human (GRCh38)
Location 4:13392470-13392492
Sequence AGGTAAATACAGAAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970180926_970180928 12 Left 970180926 4:13392435-13392457 CCATACAAGAAATAACTTTTCTT 0: 1
1: 0
2: 2
3: 39
4: 502
Right 970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG 0: 1
1: 0
2: 3
3: 32
4: 419
970180925_970180928 13 Left 970180925 4:13392434-13392456 CCCATACAAGAAATAACTTTTCT 0: 1
1: 0
2: 5
3: 36
4: 418
Right 970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG 0: 1
1: 0
2: 3
3: 32
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970180928 Original CRISPR AGGTAAATACAGAAGAAACT TGG Intronic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
905776830 1:40673373-40673395 AGGAAAATTCAGCAGAACCTAGG - Intergenic
906550659 1:46663812-46663834 AGGTAGTTACAGTAGAAAATTGG - Intronic
906780312 1:48567462-48567484 ATGTTAATACAGAATAATCTAGG + Intronic
906804538 1:48767645-48767667 AAGAAACCACAGAAGAAACTAGG + Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907361828 1:53923038-53923060 AGGTAAAGACAGAAAAAAACAGG + Intronic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
908567197 1:65369068-65369090 AGGCAAATAAAGAAGAAGATGGG - Intronic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
910457219 1:87410923-87410945 GGGTAAATAAAGAATGAACTGGG + Intergenic
910781815 1:90945593-90945615 AGGTTACTACAGAAGAAATGAGG + Intronic
911341209 1:96640894-96640916 AGGTAATGACATAAGAAAATTGG + Intergenic
911848691 1:102786557-102786579 AGATAAATAAAGAAGAAGCTGGG - Intergenic
912370235 1:109168062-109168084 AAGTGAAGACAGAAGGAACTTGG - Intronic
913101055 1:115566443-115566465 AGATAAATAATGAAGAAATTTGG + Intergenic
913116226 1:115699926-115699948 AGGAAAATAGAGAAGAAATAAGG + Intergenic
913131943 1:115846909-115846931 AGATAAGTACAGAGCAAACTAGG - Intergenic
913693978 1:121306439-121306461 AGGTATATAAGGAAGACACTGGG + Intronic
914143586 1:144973628-144973650 AGGTATATAAGGAAGACACTGGG - Intronic
916393546 1:164359917-164359939 AAGGAAGAACAGAAGAAACTTGG - Intergenic
917559536 1:176133953-176133975 AGTAAAATATAGAAGAAAATCGG + Intronic
917975843 1:180237116-180237138 AGGGATAGACAGAAGAAATTGGG - Intronic
918222506 1:182448523-182448545 AGGTAAATATAGAAAATATTGGG - Intergenic
918635964 1:186774519-186774541 AGGAAAATACAGAGGAAAGCGGG - Intergenic
918688086 1:187444801-187444823 AGGGAAATAAAGAAGAAAGAAGG - Intergenic
918766250 1:188487339-188487361 AGGTTAAGAAGGAAGAAACTAGG - Intergenic
918779746 1:188684344-188684366 GGACATATACAGAAGAAACTGGG + Intergenic
918841905 1:189551911-189551933 AGGTAAAAACTAAGGAAACTTGG - Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
920019148 1:202940840-202940862 AAGAAAGTACAGAAGACACTTGG - Exonic
921425647 1:214998147-214998169 AGGTAAAGGGAGAAGAAATTGGG - Intergenic
923549677 1:234953521-234953543 AGGTGAATAGATAATAAACTGGG - Intergenic
923575505 1:235155210-235155232 AGGAAAATTCAGAAGACATTGGG - Intronic
923790533 1:237107579-237107601 AGGTAAATGTAAAAGCAACTTGG - Intronic
923932458 1:238717567-238717589 AGCTAATTGCACAAGAAACTAGG - Intergenic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1063264134 10:4427429-4427451 ATGTAAATAAAGTAGAAACGTGG - Intergenic
1064584266 10:16823537-16823559 AGGTAAACACAGGTGAGACTTGG + Intergenic
1065167537 10:22995550-22995572 AGGGAAATGCATAAAAAACTAGG - Intronic
1065259180 10:23907192-23907214 AGGTAAAGACAAAAGAAAGGAGG - Intronic
1065434152 10:25690018-25690040 AAGGAAATACAGAAGATTCTGGG - Intergenic
1065486580 10:26241642-26241664 ACGTACAGACAGAGGAAACTTGG - Intronic
1065917507 10:30365595-30365617 AGGCATATACAGAACAAACGGGG + Intronic
1067260834 10:44689689-44689711 AGAAAAATACAGAAGAAACATGG - Intergenic
1068078545 10:52289738-52289760 AGGGAAAAAAAGAAGAAAATGGG + Intronic
1068794602 10:61064795-61064817 TAGTAAATGCAGTAGAAACTAGG - Intergenic
1068965336 10:62906301-62906323 TGGTATATACATAATAAACTTGG - Intronic
1069086147 10:64141878-64141900 TGGTAAATCCATAAGAACCTAGG + Intergenic
1069311765 10:67046246-67046268 AGGTAAATTAAGGAGAAAATAGG - Intronic
1069848317 10:71388523-71388545 GGGTAAATACAAATGAATCTTGG - Intergenic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1071945836 10:90643949-90643971 AGGTAAAAACTAAAGAAACATGG + Intergenic
1072074136 10:91951441-91951463 AAATTATTACAGAAGAAACTTGG + Exonic
1072413172 10:95224384-95224406 AGGTCAATAAAGAAGCCACTCGG + Intronic
1072559119 10:96553873-96553895 ATGTAAATAAAGAAATAACTGGG - Intronic
1072677103 10:97475796-97475818 AAGTAAAAACAGAAGAATGTGGG + Intronic
1073088179 10:100909173-100909195 AGATAACTCTAGAAGAAACTTGG + Intergenic
1073619476 10:105031829-105031851 AGGGAAAAACTGTAGAAACTTGG - Intronic
1076183049 10:128425506-128425528 AGGTGATCACAGAAGGAACTGGG - Intergenic
1076276566 10:129204400-129204422 AGGAGAAAAGAGAAGAAACTGGG + Intergenic
1076613797 10:131743353-131743375 AGCTAAATAAAGAAGGCACTGGG + Intergenic
1077073778 11:690386-690408 CAGTAAAAACATAAGAAACTTGG - Intronic
1080047868 11:27828048-27828070 AGGTGAAAATAGAAGAAAATGGG + Intergenic
1080125285 11:28726700-28726722 AGGGAAATACAGAAGAATCTAGG - Intergenic
1080151629 11:29058026-29058048 AGGTAAATACTGAGCTAACTTGG - Intergenic
1080350396 11:31378781-31378803 AGGAAATTACACTAGAAACTTGG + Intronic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1080909288 11:36579842-36579864 AGAGAAATACAGAATAAATTTGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086284097 11:85225551-85225573 GGGAAAGTACAAAAGAAACTGGG - Intronic
1087384996 11:97459918-97459940 AGGGAAACACAAAAGAAAATGGG + Intergenic
1087773192 11:102233512-102233534 AGGTGATTACAGTAGTAACTGGG + Intergenic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1089342739 11:117770421-117770443 AGGAACACACAGAAGCAACTCGG + Intronic
1089374411 11:117984426-117984448 AGGGAAACCCAGAAGAGACTGGG + Intergenic
1089493582 11:118897931-118897953 AGGTAAAGACAGAAGGAAAATGG + Exonic
1089774961 11:120829634-120829656 GGGTAAATACAGGAGTAACATGG + Intronic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1090412425 11:126518532-126518554 AGGCAAATACAGACTAAATTAGG + Intronic
1090486432 11:127116477-127116499 AGGCAATTAGAGAAGAAAATAGG - Intergenic
1090930135 11:131290304-131290326 AGGAAAATAGAGAAAAGACTGGG - Intergenic
1091513858 12:1158087-1158109 AGATAATCACAGGAGAAACTAGG - Intronic
1091908811 12:4212190-4212212 AGCCAAATACAGAATAAACATGG - Intergenic
1093268730 12:17030794-17030816 AGAAAAATGCAGCAGAAACTAGG + Intergenic
1094426262 12:30320328-30320350 AGATAAACACAGATGAAAATAGG + Intergenic
1094614236 12:32022031-32022053 AGGTATATAGAGAAGAAAAGGGG + Intergenic
1094802681 12:34055265-34055287 AATTAAATTTAGAAGAAACTTGG - Intergenic
1095115842 12:38351205-38351227 AATTAAATTTAGAAGAAACTTGG - Intergenic
1095725789 12:45451429-45451451 ATGTAAATACTCAACAAACTAGG + Intergenic
1095811751 12:46379270-46379292 AGTTAAATACATAAGAAGCTGGG - Intergenic
1097009532 12:55942320-55942342 AGGCACTTAGAGAAGAAACTAGG + Intronic
1097725310 12:63069013-63069035 AGGAAAATACTGAATAAGCTGGG + Intergenic
1098635887 12:72782748-72782770 AGGTTAAAACAGAACAGACTAGG + Intergenic
1099310979 12:81022522-81022544 AGGTAAATCTGGATGAAACTTGG + Intronic
1101165257 12:102023649-102023671 AGCTAAATGCAGTTGAAACTGGG + Intronic
1101808705 12:108089508-108089530 AGGCAAATAAAGAAAAAACAAGG - Intergenic
1101894661 12:108746955-108746977 ATGTTAATACAGAGGTAACTGGG + Intergenic
1101919527 12:108921076-108921098 TAGTAAATAAAGAAGAATCTGGG + Intronic
1102350668 12:112189678-112189700 AGGGAAATAAAGAGGAAAGTTGG - Intronic
1102542515 12:113632581-113632603 AGGTAGATGGAGAAGAAAATTGG - Intergenic
1103000439 12:117381719-117381741 AGGTAAATACTGAAGGAAATCGG + Intronic
1103401138 12:120643533-120643555 AGTTAAAAACAAATGAAACTTGG - Intronic
1103413337 12:120727933-120727955 AAGTAAATAAAAAAGAAAATAGG - Intronic
1103834908 12:123810846-123810868 AGGTAAATAAATAGGAAAGTTGG + Intronic
1104866248 12:131956680-131956702 AGGGAATTACAGAAGCAATTTGG - Intronic
1107100206 13:36582201-36582223 CAGTAAATACAGTAGGAACTAGG - Intergenic
1107603547 13:42037897-42037919 AAGTATATACAGTAGAACCTTGG + Intergenic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1108855943 13:54792404-54792426 AGGAAAATTCAGCAGAATCTAGG + Intergenic
1108954782 13:56139290-56139312 AGGTAATTAGAGAATAAACAGGG - Intergenic
1109077774 13:57859612-57859634 AGAAAAATAGAGAAGAAAATGGG - Intergenic
1110453188 13:75660290-75660312 AGATAAATACAGAGTAAAATGGG - Intronic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1112545570 13:100366048-100366070 AGGTTAATAAAGATGTAACTTGG + Intronic
1112630488 13:101156467-101156489 AGGTAAATATATACAAAACTAGG - Intronic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1112908066 13:104448137-104448159 AGGTATATCAAGAAGCAACTAGG + Intergenic
1112918727 13:104583405-104583427 AGATAAATACAGCAGAAAGAGGG + Intergenic
1114734658 14:25031992-25032014 TGGAAAATACAGAAGAAATATGG + Intronic
1114974927 14:28083757-28083779 GGGTAAGTACAAAAGAAACATGG + Intergenic
1115218252 14:31033855-31033877 AGACAATTACAGAATAAACTTGG - Intronic
1115472246 14:33779904-33779926 AGGTAAATACAAAGGCCACTTGG - Intronic
1116234377 14:42259229-42259251 AGGTAAGTACTGGAGAAATTAGG - Intergenic
1117477314 14:56109497-56109519 GGAAAAATACACAAGAAACTGGG + Intergenic
1117843311 14:59883216-59883238 AAGTAAAGAAAAAAGAAACTAGG - Intergenic
1119272624 14:73322469-73322491 AGGTGTATAGAGAAGAAAATTGG + Intronic
1119352487 14:73977517-73977539 AAGAAACTAGAGAAGAAACTAGG + Intronic
1119784737 14:77304273-77304295 AGGTAAATGCAGAAGTAGCTGGG - Intronic
1120347126 14:83305175-83305197 TTGTAAATAGAGAACAAACTTGG - Intergenic
1120629651 14:86874559-86874581 AGGAAAATCCAGGAGAAACCAGG - Intergenic
1122017891 14:98812024-98812046 TGTTAACAACAGAAGAAACTGGG - Intergenic
1123459427 15:20455811-20455833 AGGGAAGTCCAGAGGAAACTAGG - Intergenic
1123658634 15:22544607-22544629 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1124265657 15:28231632-28231654 AGGGAAGTCCAGAGGAAACTAGG - Intronic
1124312499 15:28639103-28639125 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127565200 15:60181155-60181177 AGGTAAACACTGAAGAAATGTGG + Intergenic
1129160330 15:73743908-73743930 AGCTAAATACTTAAGAACCTGGG + Intronic
1130436958 15:83910078-83910100 AGGAAAAAACAGAAGAAACATGG - Intronic
1131308437 15:91266301-91266323 AGGGAAATACAGATGCGACTGGG - Intronic
1131353202 15:91720363-91720385 AGGAGAAGACAGAAGAAAGTGGG + Intergenic
1132244375 15:100283000-100283022 TGGAAAATACAGAGGAAAATAGG - Intronic
1133247676 16:4460023-4460045 AAAGAAATACAAAAGAAACTAGG - Intergenic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1133951401 16:10397027-10397049 ATCTACATGCAGAAGAAACTAGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134558084 16:15183428-15183450 AAGGAAATAGAGAAGAGACTTGG - Intergenic
1134918617 16:18095030-18095052 AAGGAAATAGAGAAGAGACTTGG - Intergenic
1135561944 16:23483456-23483478 AGGTAAATAAAGAAGTTACGTGG + Intronic
1136178834 16:28537415-28537437 AGAAAGCTACAGAAGAAACTGGG - Intronic
1136703835 16:32169018-32169040 AGGGAAGTCCAGAGGAAACTAGG - Intergenic
1138125446 16:54434742-54434764 AGCTAATTACAAAGGAAACTGGG - Intergenic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1140689211 16:77465396-77465418 AGGTATATACCCAAGAAAGTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1203066221 16_KI270728v1_random:1020710-1020732 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1144087619 17:11824980-11825002 AGGTAAATAAAGAAAAAAAAAGG - Intronic
1144505371 17:15825335-15825357 TGATAAAAACACAAGAAACTAGG - Intergenic
1144646806 17:16980743-16980765 AGGTAAATGGACAAGAAAGTTGG + Intergenic
1145005166 17:19333452-19333474 AGGTAAATTCTGGAGACACTGGG + Intronic
1145169551 17:20643256-20643278 TGATAAAAACACAAGAAACTAGG - Intergenic
1145233421 17:21191524-21191546 AGTCAAATACAGAAACAACTGGG - Exonic
1147128605 17:38391769-38391791 AAGTAAAAAGAGAATAAACTAGG - Intronic
1148003849 17:44408782-44408804 AGGTAGATACGGAAGAAGATGGG + Intronic
1149095890 17:52840129-52840151 AGCTAAAAACTGAAGAAACTTGG + Intergenic
1149149056 17:53537107-53537129 CAGTAAATACAGTAGAAATTAGG - Intergenic
1149227651 17:54493668-54493690 AGGAAAATCTAGAAGAAAATGGG + Intergenic
1150035913 17:61797206-61797228 ATAGAACTACAGAAGAAACTAGG + Intronic
1150323812 17:64239244-64239266 AGGTAATAACAGAAAAAACTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150471281 17:65439488-65439510 AGGCAAATCCAGGAGAGACTAGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1153129283 18:1835933-1835955 AGGTAACTAAAGAAAAAAATGGG + Intergenic
1153186480 18:2491722-2491744 TGGAAAATACTGAAGAATCTAGG + Intergenic
1153434516 18:5055062-5055084 AGGTCAAAGCAGAAGAAAGTAGG + Intergenic
1153720407 18:7896103-7896125 AGGTCAACACAGAAGCAATTAGG - Intronic
1154122528 18:11663514-11663536 AGGGAAACACAGAGGTAACTGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155837683 18:30607161-30607183 ACCTAAATAGAGAAGAGACTGGG - Intergenic
1156027846 18:32676552-32676574 AGGTAAATACTGAAGCATTTAGG + Intronic
1156617465 18:38804412-38804434 AGGGAAATAGAGAAGAAAAATGG - Intergenic
1156811563 18:41259172-41259194 AGGTAAAAAGAGAAGAAAACAGG + Intergenic
1156833728 18:41527338-41527360 AGATAAAAACAATAGAAACTGGG - Intergenic
1156856587 18:41789398-41789420 AGGTGAATACTGATGAAAATGGG + Intergenic
1156944433 18:42811984-42812006 GGGTACATAAAGAAGATACTTGG + Intronic
1157130678 18:45004563-45004585 AGGTAAATGAAAAAGAAACAGGG + Intronic
1157889905 18:51405735-51405757 AAGCTAATACAGAAGAAAGTTGG - Intergenic
1157959447 18:52136082-52136104 AGGTAACTACAAAAGATACTTGG - Intergenic
1158860447 18:61586669-61586691 AGGAAGCTATAGAAGAAACTGGG + Intergenic
1162036469 19:7942631-7942653 AAGTAAATACAGGAGATAGTAGG - Intronic
1165951886 19:39478636-39478658 AGGGAAAGACACAAGGAACTCGG - Intergenic
1166038208 19:40185190-40185212 AGCTAAAAAGAAAAGAAACTAGG + Intergenic
1168306147 19:55437459-55437481 AGGTAATTCCAGAACGAACTTGG + Intronic
1168612291 19:57811068-57811090 CAGTAAATACTGAAGGAACTCGG + Intronic
924989266 2:297759-297781 AGGTGAATACAGAGGAAATGTGG - Intergenic
926521878 2:13925885-13925907 AGTTAAAAACACAATAAACTAGG - Intergenic
926521880 2:13925960-13925982 AGTTAAAAACACAATAAACTAGG - Intergenic
926853279 2:17224609-17224631 AAGAAAATACAGAATGAACTTGG + Intergenic
928753708 2:34499234-34499256 AGGTAGATAAAGAAGAAAAGGGG + Intergenic
928813319 2:35255706-35255728 AAATAAAAACAGTAGAAACTGGG + Intergenic
930220095 2:48737634-48737656 AGGTAAATGCTGAAGACAATAGG - Intronic
931332512 2:61302550-61302572 AGGAAAATTTAGAAGAAAATAGG - Intronic
932018347 2:68056426-68056448 AGGTAAAAATACAAGAAATTAGG - Intronic
932516982 2:72361163-72361185 AGGTAAATTCAGCAAAAACAGGG + Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933848156 2:86342475-86342497 ATGTAATTATAAAAGAAACTGGG - Intergenic
935034519 2:99355998-99356020 TAGTAATAACAGAAGAAACTAGG - Intronic
935334111 2:101999190-101999212 AGACAAAGACAGAAGAAACAAGG - Intronic
935559666 2:104547253-104547275 GGTTAAGAACAGAAGAAACTGGG + Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
937685916 2:124697178-124697200 ATGTGAATAATGAAGAAACTGGG - Intronic
939831944 2:147082706-147082728 AAAGAAATACAGCAGAAACTTGG + Intergenic
940518211 2:154708558-154708580 AATTAAATACAGAAAAAAATGGG - Intronic
940532435 2:154895581-154895603 AAGTTAAAACAAAAGAAACTTGG + Intergenic
940820286 2:158346422-158346444 AGGGACATACAGAAGAAGCAAGG - Intronic
941177911 2:162221931-162221953 AGGTAAATACAGCATAATTTAGG - Intronic
942264624 2:174209648-174209670 AGCTGCATACAGTAGAAACTTGG + Intronic
943024520 2:182611109-182611131 AGGGAGATAGAGAAGAAACTGGG - Intergenic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
943936188 2:193919547-193919569 ATGTAAGGACAGAAGAGACTAGG + Intergenic
943996664 2:194775909-194775931 AGTTATAAACAAAAGAAACTAGG + Intergenic
944177771 2:196851888-196851910 ATGTAAATTCCGTAGAAACTCGG - Intronic
944333986 2:198507278-198507300 AGGCAAATAAAGAAGAAAAAAGG + Intronic
944977278 2:205068983-205069005 AGGTAAATATAGCAAAAAGTAGG - Intronic
947053473 2:226074177-226074199 GAGTAAATATTGAAGAAACTGGG + Intergenic
1172343188 20:34175597-34175619 AGGTAAATATAGAAGAGAGAAGG + Intergenic
1172574714 20:35999365-35999387 AGGGAAAAACAGAAGAAAAAGGG - Intronic
1174242861 20:49152203-49152225 AGGGAAATGGATAAGAAACTGGG - Intronic
1177627211 21:23678051-23678073 AGGAAAATATAGGAGAAAATAGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178511567 21:33209488-33209510 AGGAAAAGACAGAGTAAACTAGG + Intergenic
1178606946 21:34046066-34046088 AAGTAACTTCAGAAGAAACAAGG + Intergenic
1178986108 21:37304551-37304573 AGATAAATCCAGAATAGACTTGG + Intergenic
1180620015 22:17154947-17154969 AGGTACACACAGAAGAATTTAGG + Intronic
1181828550 22:25539853-25539875 AAATAAATACAGAATAAAATAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182360431 22:29743407-29743429 AGGAAAAATCAGAGGAAACTAGG - Intronic
1182509390 22:30808173-30808195 AGGTATACACAGAAGACACAGGG + Intronic
1182559390 22:31147897-31147919 AGGGAAATCCAGTAGAAACAAGG + Intergenic
1182647277 22:31820466-31820488 AGGCAAGTACAAAAGAAAATAGG - Intronic
1183280863 22:36931702-36931724 GGGTAAAGAAAGCAGAAACTGGG - Intronic
1183981936 22:41545919-41545941 AGGTACTTACAAAAGATACTTGG + Intergenic
1184932930 22:47694794-47694816 AAGTAAAAATAGCAGAAACTTGG - Intergenic
1184936042 22:47722119-47722141 AGTTAAATACATAAAAAAATTGG + Intergenic
1185207390 22:49547978-49548000 ATGTGAACACAGGAGAAACTAGG - Intronic
949384700 3:3488226-3488248 ATGTAGATACAGCAGAGACTGGG + Intergenic
949571495 3:5297839-5297861 AGGGAAATGGAGAAGATACTGGG + Intergenic
951102883 3:18709774-18709796 AGGAAAAAACAGGAGAAAATTGG + Intergenic
951878738 3:27459194-27459216 AGGGAAAAGAAGAAGAAACTAGG + Intronic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
952180050 3:30907624-30907646 TAGTAAATACACAAGAAACGTGG + Intergenic
952429403 3:33207411-33207433 ACGAAAAAACAGAAGAACCTGGG + Intronic
952596390 3:35023651-35023673 AAGCAAGTAAAGAAGAAACTAGG + Intergenic
953252127 3:41254896-41254918 AAGAAAAAAAAGAAGAAACTAGG + Intronic
953460034 3:43074568-43074590 ATGTAACTACGGGAGAAACTGGG - Intergenic
953479596 3:43239284-43239306 AGGTAAAGAAAAAAGATACTTGG + Intergenic
953618108 3:44510349-44510371 AGATAAAGCCAGAAGAAACCGGG + Intronic
954018059 3:47713020-47713042 AGTTAAAAACAGAAAAATCTGGG + Intronic
954544114 3:51418073-51418095 AGGTAAATAAAGCACAGACTAGG + Intronic
954777195 3:53030317-53030339 ATAAAAATACAAAAGAAACTGGG + Intronic
956932544 3:74061263-74061285 ATGTCAATACAGAACAAACTAGG + Intergenic
957146426 3:76430087-76430109 AGTTAATTACAGAAGACATTAGG + Intronic
957895738 3:86419323-86419345 AGCTGAATACATAAGAAACTAGG - Intergenic
957901219 3:86494803-86494825 AGGAGAATACAGAAGAAAAAAGG + Intergenic
958103271 3:89041352-89041374 AGGTATATACACAAGAAAAATGG + Intergenic
960009690 3:112820348-112820370 AGGTAAATAAAAATGAAAGTAGG - Intronic
960066774 3:113382753-113382775 AGGTGAATACAGAGGTAAATGGG + Intronic
960780977 3:121316296-121316318 AGGTAAATTCAGAAGGAGCTAGG + Intronic
960841927 3:121967813-121967835 TGTTAATAACAGAAGAAACTAGG - Intergenic
961968253 3:130928598-130928620 AGGTCAATACAGACTAAACAAGG - Intronic
963592420 3:147278747-147278769 AGGCAAATACATTACAAACTGGG - Intergenic
965165766 3:165193559-165193581 AGCAAAATGCAGGAGAAACTCGG - Intronic
965396661 3:168167400-168167422 TGTTAATAACAGAAGAAACTGGG + Intergenic
965950465 3:174302313-174302335 AGGAAAATAAATAAGAAATTTGG - Intergenic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970830357 4:20332119-20332141 AGGTATATACACAAGAGAATTGG - Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
972929932 4:44060054-44060076 TGAAAAATACAGAAGAATCTGGG + Intergenic
973108496 4:46370861-46370883 AGGCAAATAGAGTAGAAAATAGG - Intronic
973206346 4:47564662-47564684 AGGCAAAAATAGAAAAAACTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974154514 4:58054094-58054116 AAGTAAAAACAGAAGAAAAATGG - Intergenic
975713703 4:77185914-77185936 AGATAAACAGAGAAGGAACTGGG - Intronic
975780503 4:77834394-77834416 ATATATATAAAGAAGAAACTAGG + Intergenic
977293129 4:95184528-95184550 AGGTATATACAAATGACACTTGG + Intronic
977449157 4:97172590-97172612 AGGTAAAGGAAGAAGAAAATAGG + Intergenic
977570469 4:98623851-98623873 ACGTGAATACAGAGGAAACATGG - Intronic
977668822 4:99671661-99671683 TGGGAAATACCGAGGAAACTAGG + Intergenic
978216156 4:106206606-106206628 ATGTAATTACAGGAAAAACTAGG - Intronic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
979980622 4:127250201-127250223 AGTTAAATACAAAAGGAAATGGG + Intergenic
980320250 4:131263241-131263263 AGGTAAATAATAAAGAAACTTGG + Intergenic
980663074 4:135892834-135892856 ATGTAAGTATAGGAGAAACTTGG + Intergenic
981612594 4:146611106-146611128 AAATACATACAGAAGAAAGTGGG - Intergenic
981641557 4:146949636-146949658 AGCTAAAAACAGAAGAAACTAGG - Intergenic
981884231 4:149653577-149653599 AGGGAATTGCAGAAGAAAATAGG - Intergenic
983216991 4:165011070-165011092 ACGGACATTCAGAAGAAACTCGG + Intergenic
983782362 4:171686022-171686044 ATAAAAATACAGAAGAAACAAGG + Intergenic
985250406 4:188018490-188018512 AGTTATATACAGAAGAGGCTGGG - Intergenic
985319315 4:188691692-188691714 AACTGAATAAAGAAGAAACTTGG + Intergenic
987168311 5:15224363-15224385 GGATAGATACACAAGAAACTAGG - Intergenic
987306070 5:16639066-16639088 AGATAAATAAAGATGAAAATTGG - Intergenic
987982598 5:25106065-25106087 AGCTAAATACTGAATAAACATGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989495602 5:42108280-42108302 AGAGAATTACATAAGAAACTGGG - Intergenic
990758549 5:59102836-59102858 AGCTAAATAAAGAAGACACTTGG + Intronic
992630120 5:78671649-78671671 TGGCAAATAGAGAAGAACCTTGG + Intronic
992764321 5:79982295-79982317 ACCTAAATACAGAACAAATTGGG + Exonic
992816945 5:80451483-80451505 AGGAAAATACATAGAAAACTTGG + Exonic
993168945 5:84391445-84391467 AGAGAAACACAGAAGAAAATTGG - Intergenic
993273463 5:85825293-85825315 AGTTATATACAGAAAAAAATAGG + Intergenic
993934292 5:93982359-93982381 AGGTAAATTTAGAAGTAAATAGG - Intronic
994066528 5:95549388-95549410 AGTTAAATACAGCAGCAAATAGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996072494 5:119149439-119149461 AGCCATCTACAGAAGAAACTAGG - Exonic
997183208 5:131854526-131854548 AGGAAAAAACAGAAGAATCCTGG + Intronic
999528382 5:152433920-152433942 AGCTTAAGAGAGAAGAAACTGGG - Intergenic
999551857 5:152696292-152696314 AGGTAAAAACTGAAGAAATCTGG - Intergenic
999920031 5:156308048-156308070 AGGTAAATACAAGGGAAATTAGG - Intronic
1000300582 5:159952777-159952799 AGAAAAATACAGAAGATAGTGGG - Intronic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1000774313 5:165398821-165398843 TGGTAACTACAGATGAAAGTGGG - Intergenic
1001585066 5:172828217-172828239 AGGAAAACAAAGAAGAACCTGGG + Intergenic
1002650755 5:180691459-180691481 AGGTAAATTCTGAAGAAAACAGG + Intergenic
1003075290 6:2978694-2978716 TGGTAAATAAATAATAAACTGGG + Intergenic
1005386711 6:25292623-25292645 TCCTAACTACAGAAGAAACTGGG - Intronic
1005739452 6:28776665-28776687 AGCAAAGTACAGAAGAAACAGGG + Intergenic
1007234866 6:40383441-40383463 AGGTAAATAGAGAAGACTGTGGG - Intergenic
1007338738 6:41174763-41174785 AGTGAAATACAGAAGCAGCTGGG + Intergenic
1007544739 6:42685011-42685033 AAGGAAAAAAAGAAGAAACTTGG + Intronic
1008041481 6:46805778-46805800 CCTTAAAGACAGAAGAAACTTGG - Intronic
1008460070 6:51758329-51758351 TGGTAACTTCAGAGGAAACTGGG + Intronic
1009060126 6:58388143-58388165 AGGGAAAAACTGAAGCAACTAGG + Intergenic
1009230788 6:61059249-61059271 AGGGAAAAACTGAAGCAACTAGG - Intergenic
1009913609 6:69965168-69965190 GGGTAATTAAAGAAGAAAGTGGG - Intronic
1010116833 6:72322718-72322740 AAGTAACTTCAGAGGAAACTAGG - Intronic
1010405874 6:75505222-75505244 AGGCAAATACATAAGAAAATGGG + Intergenic
1010440654 6:75889873-75889895 ATGCAAATACAGCAAAAACTAGG - Intronic
1010516302 6:76775664-76775686 AGGCAAATAAAGAAGAAATGAGG - Intergenic
1010673424 6:78713883-78713905 AGGTTCAGAAAGAAGAAACTAGG + Intergenic
1011493330 6:87914867-87914889 AGGTAATTTCAGAAGGAATTTGG + Intergenic
1012199759 6:96391507-96391529 AGAGAAAGACAGAAGAAACATGG + Intergenic
1012256167 6:97035101-97035123 AGATAAATAGAGAAGAATCAAGG - Intronic
1012785584 6:103621372-103621394 AAGTTAATAAATAAGAAACTAGG - Intergenic
1012922544 6:105234620-105234642 GGATAAATAAAGAAGAAAATGGG + Intergenic
1013444621 6:110211205-110211227 AGCTATATTCAGAATAAACTTGG + Intronic
1014349959 6:120328638-120328660 AGGTAAGCAGAGAAGAAACCTGG - Intergenic
1015420826 6:133006361-133006383 AGGTAACTTCTAAAGAAACTAGG - Intergenic
1015735677 6:136397547-136397569 AGGTAAATACATTTGAAAATAGG + Intronic
1016111279 6:140228579-140228601 TGTTTAATACAGAATAAACTTGG - Intergenic
1016479135 6:144462865-144462887 AGGTAAATCCAGAGGCCACTGGG + Exonic
1017579467 6:155847130-155847152 AGCTAAGTAAAGAAGAAAGTGGG + Intergenic
1017595110 6:156020001-156020023 AGGGAAATAAGGAAGAAAATAGG + Intergenic
1018780666 6:167061849-167061871 ATATAAATACTCAAGAAACTAGG + Intergenic
1021034164 7:15776019-15776041 AGGTGAGTACAAAAGAAAGTAGG - Intergenic
1023498664 7:40825194-40825216 AATTAATTACAAAAGAAACTGGG + Intronic
1024386046 7:48753152-48753174 GGATTAATAAAGAAGAAACTTGG - Intergenic
1025826943 7:65018359-65018381 AGCAAACTACAGAAGAAACAGGG + Intergenic
1025914489 7:65854778-65854800 AGCAAACTACAGAAGAAACAGGG + Intergenic
1027346854 7:77269377-77269399 AGAAAAATACAGAAAAAACACGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029684475 7:102136844-102136866 AGGTAAACACAGAAGCACGTGGG - Intronic
1030900993 7:115123255-115123277 AGTTTGATACAGAAGAAAGTAGG + Intergenic
1032435019 7:131893553-131893575 AGATTTATACAGAAGAACCTTGG - Intergenic
1032559050 7:132869263-132869285 AGGTACACAGAGAAGAAACCAGG - Intronic
1033735920 7:144221686-144221708 AGAGGAATACAGAAGAAACTAGG - Intergenic
1033747131 7:144329266-144329288 AGAGGAATACAGAAGAAACTAGG + Intergenic
1033807451 7:144970860-144970882 AGGGTAATACTGAATAAACTTGG - Intergenic
1033888206 7:145974687-145974709 AGACAAACCCAGAAGAAACTTGG + Intergenic
1033894029 7:146050439-146050461 AGATAGATACAAAAAAAACTAGG - Intergenic
1036523815 8:9516890-9516912 AGGAAAAGAAAAAAGAAACTGGG + Intergenic
1036820940 8:11938911-11938933 AAGGAAATATAGAAGAAGCTAGG + Intergenic
1036911869 8:12764240-12764262 AGGTAGAGACAGAAGAATATTGG - Intergenic
1037545664 8:19918629-19918651 AACTAAAAACAGAACAAACTAGG + Intronic
1038549997 8:28459211-28459233 AAGTATATACAAAAGAAAATTGG + Intronic
1039056825 8:33543606-33543628 AGGTAAAAACTGAAGAAAGCTGG - Intergenic
1039114106 8:34073074-34073096 AGGTAAGAACAGAAAAAAGTGGG - Intergenic
1039490671 8:37945083-37945105 AGGTAAATGGAGAGGAAAGTTGG + Intergenic
1040607820 8:48951909-48951931 AGGGACATACAGAAGTCACTGGG + Intergenic
1040904384 8:52450510-52450532 AGGTAAATACACAAGAGAAATGG + Intronic
1041352709 8:56964855-56964877 AAACAAATGCAGAAGAAACTGGG + Intronic
1041506474 8:58604154-58604176 AGCTGATTAAAGAAGAAACTTGG - Intronic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1043957335 8:86376266-86376288 AGGTAAAATAAGAAAAAACTAGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044495946 8:92882814-92882836 AGGTAAGTAGAGAGGGAACTGGG - Intergenic
1045918310 8:107500029-107500051 AACTAAATACAGCAGAAAATTGG + Intergenic
1046560785 8:115834730-115834752 AAGTACACACAGAATAAACTAGG + Intergenic
1046882517 8:119325069-119325091 AGGGAAATTCAAAACAAACTGGG + Intergenic
1046986953 8:120398342-120398364 AGGTAAAAACTGAAACAACTAGG + Intronic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1048167639 8:132077461-132077483 AGGGAAAAAGAGAAGAAATTGGG + Intronic
1048228740 8:132616317-132616339 AGCTAAATAAAGAAGAAAAAAGG - Intronic
1048426378 8:134327791-134327813 AGGGAAAAACAGAAGCAACAAGG - Intergenic
1049637694 8:143697813-143697835 AGATAAATGCAGAGAAAACTCGG - Intronic
1050118254 9:2282491-2282513 ACATAAAGACAGAAGAATCTGGG - Intergenic
1050172836 9:2840782-2840804 AGGAAAATACAGAAGGAACCTGG - Intronic
1050324852 9:4489627-4489649 AGGCAAACACAGGAGAAACTAGG - Intergenic
1050711606 9:8471660-8471682 AGGTAAGTACCGCAGAAAATTGG + Intronic
1051851040 9:21508512-21508534 AGTCAAAAACAGAAGAAACGTGG - Intergenic
1051980615 9:23011083-23011105 AATAAAATACAGAAGAAAATAGG + Intergenic
1052259404 9:26494480-26494502 AGCCAAATACAGTAGAAAGTAGG + Intergenic
1052534793 9:29732835-29732857 GGGTATCTACAGAAGAAACATGG - Intergenic
1053590744 9:39511743-39511765 AAGTAATTAGAGAAGAAACCTGG - Intergenic
1053848596 9:42267104-42267126 AAGTAATTAGAGAAGAAACCTGG - Intergenic
1054575560 9:66853546-66853568 AAGTAATTAGAGAAGAAACCTGG + Intergenic
1056265047 9:84888697-84888719 AGGTAAAGACAGAAGTCCCTGGG - Intronic
1057454513 9:95195819-95195841 AGGTATATACATAACAAAATGGG - Intronic
1057665568 9:97042387-97042409 ATGTAAATGCAGAAGAAATATGG + Intergenic
1058255189 9:102753008-102753030 ATCTTAATACAAAAGAAACTGGG + Intergenic
1059342743 9:113608387-113608409 AGGTAAATACCCAAGAAAATTGG - Intergenic
1059683328 9:116607573-116607595 TGGAAAATAAAGAAGAATCTTGG + Intronic
1059969135 9:119646782-119646804 TGGTAAATAAACTAGAAACTGGG + Intergenic
1185887030 X:3792163-3792185 GGGTAAATACAGAAAAGAATCGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187620739 X:21050873-21050895 AGCTAAAAACAGAACTAACTGGG + Intergenic
1188724127 X:33560393-33560415 AGCTAAATACTGAATACACTTGG - Intergenic
1189321337 X:40089510-40089532 ACTTAGATACAGGAGAAACTGGG - Intronic
1190414836 X:50170766-50170788 AGGTTAAGAAAGCAGAAACTGGG + Intergenic
1190526878 X:51337074-51337096 AGTTATTTACAGAAGAAACTAGG - Exonic
1190780212 X:53586739-53586761 AGGGAAATAGAAACGAAACTAGG + Intronic
1192271867 X:69588504-69588526 AGGGATATACAGAGGAGACTTGG - Intergenic
1192587072 X:72327665-72327687 GGGAAAATACACAAGGAACTGGG - Intergenic
1192655653 X:72990927-72990949 AGGTGAATACAATAGACACTGGG + Intergenic
1192840259 X:74848058-74848080 ATGGGAATACAGAAGAAAATTGG - Intronic
1193051599 X:77106376-77106398 AGCTAAAAAAAGAACAAACTAGG + Intergenic
1193491601 X:82156686-82156708 AGATGAATACAGTAGACACTTGG - Intergenic
1194003972 X:88467579-88467601 AGGCACATACAGAAGATACATGG - Intergenic
1194397008 X:93398790-93398812 TGGTAAATACAGAAAGAACCAGG + Intergenic
1194845686 X:98805362-98805384 AGGGACATTCAGAAGAAAATTGG - Intergenic
1195277693 X:103298415-103298437 AGGTAAAACCAGGTGAAACTTGG + Intergenic
1195477783 X:105306137-105306159 AGGTAAATAAAAAAGCAAATAGG - Intronic
1195533771 X:105987160-105987182 AAGTAAATAGAGAAGAAAAGTGG + Intergenic
1195849475 X:109267520-109267542 AGGGAAATAAAGAAAGAACTTGG - Intergenic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1198416295 X:136423318-136423340 AGTTAAAAACCTAAGAAACTGGG + Intergenic
1200843596 Y:7808924-7808946 AGGTAAATAAAGAATAAACTTGG - Intergenic
1200892460 Y:8338467-8338489 AAGTAAATACAGCAGAAAGTTGG + Intergenic
1200895659 Y:8373578-8373600 AAGTGAATACAGAAGAAAGTTGG - Intergenic
1201495202 Y:14585343-14585365 AAATAAATAAAGAGGAAACTTGG + Intronic
1202174036 Y:22081097-22081119 AGGTAAATACAGTATGTACTTGG - Intronic
1202217324 Y:22505285-22505307 AGGTAAATACAGTATGTACTTGG + Intronic
1202247757 Y:22837158-22837180 AAGTAAATACAGCAGAAAGTTGG + Intergenic
1202253300 Y:22894895-22894917 AAGTAAATACAGTAGAAAGTTGG - Intergenic
1202325862 Y:23690774-23690796 AGGTAAATACAGTATGTACTTGG - Intergenic
1202400745 Y:24470906-24470928 AAGTAAATACAGCAGAAAGTTGG + Intergenic
1202406290 Y:24528644-24528666 AAGTAAATACAGTAGAAAGTTGG - Intergenic
1202464492 Y:25141437-25141459 AAGTAAATACAGTAGAAAGTTGG + Intergenic
1202470035 Y:25199180-25199202 AAGTAAATACAGCAGAAAGTTGG - Intergenic
1202544909 Y:25979280-25979302 AGGTAAATACAGTATGTACTTGG + Intergenic