ID: 970189490

View in Genome Browser
Species Human (GRCh38)
Location 4:13499572-13499594
Sequence ACATGGAGAATAACCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970189484_970189490 25 Left 970189484 4:13499524-13499546 CCACAGATGTATCAGGATATTTT No data
Right 970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970189490 Original CRISPR ACATGGAGAATAACCTGGGA AGG Intergenic
No off target data available for this crispr