ID: 970191740

View in Genome Browser
Species Human (GRCh38)
Location 4:13524370-13524392
Sequence GACGCACGCCAACGCGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970191731_970191740 18 Left 970191731 4:13524329-13524351 CCACTGTGATCACCGTTTCCCGT No data
Right 970191740 4:13524370-13524392 GACGCACGCCAACGCGGGCTTGG No data
970191736_970191740 0 Left 970191736 4:13524347-13524369 CCCGTTCGAGACGCAGAGGGGAA No data
Right 970191740 4:13524370-13524392 GACGCACGCCAACGCGGGCTTGG No data
970191732_970191740 6 Left 970191732 4:13524341-13524363 CCGTTTCCCGTTCGAGACGCAGA No data
Right 970191740 4:13524370-13524392 GACGCACGCCAACGCGGGCTTGG No data
970191737_970191740 -1 Left 970191737 4:13524348-13524370 CCGTTCGAGACGCAGAGGGGAAG No data
Right 970191740 4:13524370-13524392 GACGCACGCCAACGCGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970191740 Original CRISPR GACGCACGCCAACGCGGGCT TGG Intergenic
No off target data available for this crispr