ID: 970192178

View in Genome Browser
Species Human (GRCh38)
Location 4:13527692-13527714
Sequence CCGCGCGGGGGCAGTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970192162_970192178 24 Left 970192162 4:13527645-13527667 CCACAGCAGACGTCGGAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG 0: 1
1: 0
2: 1
3: 30
4: 351
970192170_970192178 -8 Left 970192170 4:13527677-13527699 CCTGCGCGGTGGGACCCGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 98
Right 970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG 0: 1
1: 0
2: 1
3: 30
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970192178 Original CRISPR CCGCGCGGGGGCAGTGGCGC AGG Intergenic
900123414 1:1059145-1059167 CCGCGCGGGCGGAGAGGCGCTGG + Intergenic
900174977 1:1287616-1287638 CGGTGCGGGGGCAGGGGTGCAGG + Intronic
900191610 1:1354566-1354588 CCCAGCGGGGGCCGTGGCCCGGG - Intronic
900240662 1:1615875-1615897 CGGCCCGGGGCCAGCGGCGCTGG + Intronic
900368169 1:2319946-2319968 CTGCCCGGGGGCAGAGGGGCGGG - Intergenic
900429642 1:2595613-2595635 CCGGGTGGGGGCAGGGGCCCTGG + Intronic
901410395 1:9079017-9079039 CCGCGCGTGGGCACTGGGGTTGG - Intronic
901673077 1:10867221-10867243 CCGCGCGGGGGCCGTGAGGGAGG + Intergenic
901857564 1:12054139-12054161 CCGGGCGAGGGCAGAGGGGCCGG + Intergenic
902933352 1:19746519-19746541 CAGCGCCGGGGCAGCGGCTCTGG - Exonic
903326302 1:22570781-22570803 CCGCGCTCAGGCAGTGGTGCTGG - Intronic
903813254 1:26046369-26046391 CCGCGCGGGAGAGGGGGCGCAGG - Intergenic
904769069 1:32870914-32870936 CCGCGCGGCGGCGGTGGCGGCGG + Intronic
905037949 1:34929705-34929727 CTGCGCGGGGGCGGGGGCGGGGG - Intergenic
906102670 1:43273126-43273148 CCGAGCAGGGGCAGGGGCGGCGG - Exonic
906263157 1:44407913-44407935 CCGCGCGGGGCCCGCGGGGCAGG - Intronic
906532813 1:46533191-46533213 CCGCGCCGGGCCCGTGGCGCTGG - Intergenic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
908527425 1:65001456-65001478 CCGAGCGTTGGCAGTGGCGTGGG - Intergenic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
908714387 1:67054164-67054186 CCGCCCAGGGGCAGGGACGCCGG + Intergenic
909958030 1:81802161-81802183 CCGCGCGGGGACAGGCGCGGAGG - Intronic
910936496 1:92486959-92486981 CCGCGCGGGGGCAGCGCCGGCGG + Intergenic
911144797 1:94541806-94541828 CCGGGGGCGGGCAGAGGCGCGGG - Intergenic
912315100 1:108661150-108661172 CCGCGGGGAGGCCGAGGCGCGGG - Intronic
912625741 1:111203831-111203853 CTGGGCAGGGGCAGGGGCGCTGG + Intronic
912625828 1:111204137-111204159 CTGCGCGGGGGCAGGTGAGCGGG - Intronic
912685005 1:111755576-111755598 CGGCGAGAGGGCGGTGGCGCCGG + Exonic
915580382 1:156809563-156809585 CCTAGCGGGGGCAGAGGCTCAGG - Intronic
915728090 1:158033050-158033072 CCGGCCGGGCGCAGTGGCTCAGG - Intronic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
918244015 1:182643320-182643342 CAGCGCGGGGGCGGGGGGGCTGG - Intergenic
922307530 1:224357123-224357145 CCTGGCCGGGGCGGTGGCGCGGG + Intronic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
922766401 1:228158689-228158711 CAGGGCGGGGGCCGCGGCGCGGG - Exonic
923400781 1:233614079-233614101 CCGGGCGGGGGCGGGGGCGGCGG + Exonic
924052286 1:240091759-240091781 CCGCGCGGGGGCAGAGGGGGCGG + Intronic
1064086241 10:12348830-12348852 CCGCGCGGGCGCCCTGGTGCTGG - Intergenic
1064086520 10:12349734-12349756 CGGCGCGGGCGCAGAGGCGGCGG - Exonic
1064230980 10:13529045-13529067 CCCCGCGGGAGGAGGGGCGCCGG + Intergenic
1064443228 10:15371423-15371445 GCGCGCCGGGGCAGTGTCGCCGG - Intergenic
1065102017 10:22340762-22340784 CCGCTCGGGGGCCGGGGCGAAGG - Intergenic
1067453767 10:46398358-46398380 GCGCGCGGGGGCGGGCGCGCGGG + Intergenic
1067583460 10:47461388-47461410 GCGCGCGGGGGCGGGCGCGCGGG - Intronic
1067633464 10:47986736-47986758 GCGCGCGGGGGCGGGCGCGCGGG - Intergenic
1069774656 10:70919425-70919447 CCGGGCGGGGGCGGTGAGGCGGG - Intergenic
1069896492 10:71683437-71683459 CCGGGCGTGGGCAGTGGCAGAGG - Intronic
1070257606 10:74825434-74825456 CGGCGCGGGGGGAGCGGGGCTGG + Intergenic
1072341861 10:94459756-94459778 CTGCCCGGGGCCAGTGGCACCGG + Intronic
1072914337 10:99527726-99527748 CTGCGCCGGGGCAGTGGTGATGG + Intergenic
1073208254 10:101779980-101780002 CCGGGCGGGCGCCGTGGGGCCGG - Intronic
1074546373 10:114404646-114404668 CGGCGCTGGGACAGGGGCGCTGG - Intronic
1076733092 10:132447883-132447905 GCGCCCGGAGGCAGGGGCGCTGG - Exonic
1076776108 10:132699192-132699214 CAGGGCGGGGGCTGTGGTGCAGG + Intronic
1076792677 10:132785511-132785533 CCGCGCGGGGGGTGCGGGGCGGG - Intronic
1076895360 10:133308830-133308852 CTGCGCGGGGGCTGTGGCTCCGG - Exonic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1081046418 11:38278858-38278880 CTGCCCAGGGCCAGTGGCGCCGG + Intergenic
1081969092 11:47186114-47186136 CCGCCCGGGGGAGGCGGCGCCGG - Intronic
1082029504 11:47594262-47594284 CCGCGCTGCGGCAGGGGCGGCGG + Exonic
1083241569 11:61392542-61392564 CCGCGGGCGGGCAGAGGGGCCGG + Exonic
1083258148 11:61508955-61508977 CCTGGCGGTGGCAGTGGCGGCGG + Exonic
1084429532 11:69103422-69103444 CTGCATGGGGGCAGTGGCCCCGG + Intergenic
1084546755 11:69818613-69818635 CCCCGCGGGGGAGGCGGCGCCGG - Intronic
1086001098 11:81986934-81986956 CTGCCCGGGGCCAGTGGCGCCGG + Intergenic
1087672885 11:101128042-101128064 CCGCGGCGGGGCAAAGGCGCTGG + Exonic
1087761809 11:102110657-102110679 CAGGGCGGGGGCGGAGGCGCCGG + Exonic
1088796996 11:113273148-113273170 CGGGGAGGGGGCAGAGGCGCTGG - Intronic
1090832415 11:130428484-130428506 CGGCTCGGGGGCGGCGGCGCGGG - Exonic
1092143602 12:6200263-6200285 CCGGGCGGGGCCGGTGGGGCGGG + Intronic
1096482413 12:51951576-51951598 GCGCGCGGCGGCCGCGGCGCCGG + Intergenic
1096712070 12:53464917-53464939 ACACGGGGGGCCAGTGGCGCTGG + Intronic
1096814919 12:54195998-54196020 GCGGGCGGGGGCAGTGGGGCCGG - Intergenic
1096874193 12:54614502-54614524 CTGCCCTGGGGCAGTGGGGCTGG + Intergenic
1097086043 12:56469166-56469188 CCGGGAGTGGGCAGTGGTGCTGG + Exonic
1097281437 12:57847123-57847145 TGGCGCGGGGGGAGTGGCCCGGG - Intergenic
1097981672 12:65742334-65742356 CCGGGCAGGGGCAGGGACGCTGG - Intergenic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1101466907 12:104958325-104958347 CCGCGCGGGGGCGGGGCGGCGGG - Intronic
1102254028 12:111405948-111405970 CCGGGCGGAGGCGGTGGCCCGGG - Exonic
1103392551 12:120584836-120584858 CCGCGAAGGGGCAGCGGCGGGGG + Intergenic
1103509697 12:121466520-121466542 CCGCACGGCGGCAGCGGCGGCGG - Intronic
1104901159 12:132190193-132190215 CCGCGCGGCGGGAGAGGGGCCGG - Intergenic
1105593874 13:21818045-21818067 CTGCCTGGGGCCAGTGGCGCCGG - Intergenic
1106414839 13:29537937-29537959 CCGGGCGGGCGCAGTGCAGCAGG + Intronic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1108373444 13:49792642-49792664 GCGCGAGGTGGCAGTAGCGCCGG + Exonic
1108845657 13:54676672-54676694 CTGCCTGGGGCCAGTGGCGCCGG - Intergenic
1112290828 13:98143130-98143152 CGGCGCGGGCGCAGCGGTGCGGG + Intronic
1112505031 13:99970399-99970421 CCGGCCGGGGGCGGTGGCGGCGG + Exonic
1113312034 13:109140998-109141020 CCGGGCGGGGGCGGGGGCGGGGG - Exonic
1113569946 13:111346418-111346440 CTGCGCGAGGGCAGAGGCCCCGG - Intergenic
1113741445 13:112714864-112714886 CTGCGGGGGGGCAGTGGTGATGG - Intronic
1113853552 13:113431491-113431513 CTGCGCGGGGGCAGAGCCGTAGG - Intronic
1115284241 14:31700647-31700669 CTGCCCGGGGCCAGTGGCACTGG - Intronic
1115747185 14:36449716-36449738 CAGCGTGGGGGCAGGGGCACAGG + Intergenic
1117974150 14:61281153-61281175 CCGCGCGGGGACCGACGCGCGGG + Exonic
1117978820 14:61322078-61322100 CGGGGCCGGGGCAGCGGCGCCGG + Exonic
1118375245 14:65171140-65171162 CCAGGAGGGGGCAGTGGGGCTGG + Intergenic
1119357521 14:74019354-74019376 CCGCGCGCCGTCAGCGGCGCGGG + Exonic
1121074928 14:91060244-91060266 CCGCGCGGGGCTGGGGGCGCGGG - Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1121751719 14:96363281-96363303 TCGCGCGGCGGCAGTGGCGGTGG - Exonic
1122137878 14:99645178-99645200 CCCCGCGGGGGAAGAGGCGGAGG - Exonic
1122315554 14:100824312-100824334 CCTCTCGGGGGCAGAGGCGAGGG - Intergenic
1122558459 14:102593547-102593569 GCGCAAGGGGGCAGCGGCGCCGG - Intronic
1122956548 14:105074082-105074104 CACCGCGGGAGCAGTGGCGGAGG - Intergenic
1122960980 14:105093528-105093550 GCGCGCGGGGCCCGGGGCGCGGG - Intergenic
1125301023 15:38253067-38253089 GGGCGCGGGGGCAGCGGCACAGG - Exonic
1126697998 15:51341791-51341813 TCGCGCTGTGCCAGTGGCGCGGG + Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129016565 15:72474236-72474258 CCACGCAGGGGCGGTGGGGCGGG + Intergenic
1129440633 15:75578778-75578800 CCGCCCGGCGGCGGTGGCGGGGG - Exonic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1131257350 15:90871465-90871487 CCGCGCGGGGCCGGACGCGCTGG + Intronic
1131582389 15:93657455-93657477 CCGGCCGGGTGCAGTGGCTCAGG - Intergenic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1132735181 16:1382447-1382469 CGGGGCGGGGGCAGGGGCACAGG - Intronic
1132851519 16:2026964-2026986 CCGCCCGCGGGCAGGGGCGCGGG - Exonic
1132929397 16:2451222-2451244 GCGCGCGGGGCAGGTGGCGCGGG + Intronic
1133040882 16:3059245-3059267 CCGCGCAGGGGCGGCGGCGGCGG + Exonic
1134107381 16:11494152-11494174 CTGGGCGGGGGCAGTGGCATGGG + Intronic
1135470217 16:22723201-22723223 CCACCCGGGGCCGGTGGCGCTGG + Intergenic
1135598265 16:23760039-23760061 CTGGCCGGGGGCAGTGGCTCAGG + Intergenic
1136351522 16:29711671-29711693 CCAGCCGGGGGCAGTGGCTCAGG - Intergenic
1137037006 16:35576149-35576171 CCTGGCGGGGGCAGGGGCACGGG + Intergenic
1138531957 16:57639414-57639436 CAGCGCGGGAGAAGGGGCGCAGG - Intronic
1139954320 16:70686000-70686022 CGGCGCGGGGGGCGCGGCGCGGG + Exonic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1142135986 16:88452355-88452377 CCGAGAGGGGGCTGTGGCCCGGG + Intergenic
1142136422 16:88453792-88453814 CAGCGCGGGGGGCGCGGCGCGGG - Intronic
1142173823 16:88635846-88635868 CAGGGCGGCGGCAGTGGGGCAGG - Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144527213 17:16000061-16000083 CCGGGCGGGGACAGGGGCGCGGG + Intronic
1144828769 17:18120733-18120755 CTGGGCGCGGGCTGTGGCGCGGG - Exonic
1146053309 17:29568665-29568687 CGGCGCGGGGGCGCTGGGGCTGG + Exonic
1146377293 17:32303220-32303242 CCGTGCTGGGGCAGGGGCGAGGG + Intronic
1147193229 17:38748909-38748931 CCCCTCGGCGGCAGGGGCGCTGG + Intronic
1147614047 17:41818186-41818208 CCATGCGGGGGCAGTGGGGCGGG - Exonic
1149475414 17:56956986-56957008 CAGGCCGGGGGCAGTGGCTCAGG + Intronic
1150488662 17:65560566-65560588 CCGAGTGGCGGCAGTGGCGGGGG - Intronic
1151188898 17:72383252-72383274 CCGCCCGGGAGCAGCGGGGCTGG + Intergenic
1151537621 17:74747910-74747932 CCGAGCGGGAGCAGTTGCCCCGG + Intergenic
1151642395 17:75405629-75405651 CCGGGCGGCGGCAGCGGCGGCGG - Intronic
1152200360 17:78942140-78942162 CTGAGCTGGGGCAGTGGTGCAGG + Intergenic
1152349689 17:79777924-79777946 CCGGGCGGGGGCGGGGGCGGGGG - Intergenic
1152758845 17:82098087-82098109 CGGCGCTGGGGCCGGGGCGCGGG - Intronic
1154335264 18:13460011-13460033 CGACGTGGGGGCAGTGGCCCTGG - Intronic
1155199375 18:23503731-23503753 CCGCGCGGGGGAGGAAGCGCGGG - Intronic
1155570344 18:27185372-27185394 GCGGGCGGGGGCGGGGGCGCGGG - Intergenic
1155928729 18:31684847-31684869 CCGGGCGCGGGCAGCGGAGCCGG - Intronic
1155976772 18:32139967-32139989 CTGCCCGGGGCCAGTGGGGCCGG - Intronic
1156214097 18:34978085-34978107 CCTCGCTGGGTCAGTAGCGCTGG + Intronic
1158530471 18:58256023-58256045 CCTCGTGGTGGCAGTGGCGGAGG - Intronic
1159040683 18:63320401-63320423 CCCCGCGGGCGCAGCGGAGCGGG - Intergenic
1160022233 18:75189907-75189929 CTGCGCGGGTGAAGTGGTGCAGG - Intergenic
1160293431 18:77616522-77616544 CAGCCCTGGGGCAGTGGCACAGG + Intergenic
1160680346 19:409227-409249 TCCCGCGGGGGCGGGGGCGCGGG - Intergenic
1160745392 19:708990-709012 CGGCGCGGGGGCGGCGGCACCGG - Intergenic
1160776810 19:860437-860459 CCGCGCGGGGGCGGGGGGGGAGG - Intronic
1160793060 19:931864-931886 CCGTGGAGGGGCAGTGGCGAGGG + Intronic
1160892675 19:1387524-1387546 CAGTGCGGGGGCCCTGGCGCAGG + Intronic
1160913219 19:1484204-1484226 CTGGGCGGGCGCAGTGGCTCAGG + Intronic
1160961866 19:1725716-1725738 CCGCGCGGGGGCGCATGCGCGGG + Intergenic
1161068923 19:2250953-2250975 CCGTGCGCAGGCAGCGGCGCGGG - Exonic
1161382151 19:3971086-3971108 CGTCGCGGCGGCAGGGGCGCGGG - Intronic
1161397831 19:4054227-4054249 CCGGGCGGGGGCCGCGGCGGGGG - Exonic
1161507360 19:4651036-4651058 CCCTGCGGGGGCAGTGGGACTGG + Intronic
1161687591 19:5711050-5711072 CCTCGCAGGGGTAGTGGGGCAGG + Intronic
1162398399 19:10430935-10430957 GCGCGCGGGGCCAGGGGCTCGGG - Intronic
1162778642 19:12995564-12995586 ACGCGCGGCGGCAGCGGCGGCGG + Intergenic
1162940394 19:14005898-14005920 CCTCGCGGGGGCCGGGCCGCGGG + Intronic
1163282424 19:16325681-16325703 CCGGGCGCGGGCAGGCGCGCGGG - Exonic
1163427134 19:17245874-17245896 GCGCGCGGGGTCGGTGGCGGTGG - Exonic
1163607280 19:18281995-18282017 CCGGGCGGGGGCGGGGGCGGGGG + Intergenic
1163666634 19:18606691-18606713 CGGCTCGGCGGCGGTGGCGCAGG + Exonic
1163674144 19:18646951-18646973 CAGGGCGGGGGCAGGGGCGGCGG + Intronic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1166039145 19:40191654-40191676 CTGCGCGGGGTGAGCGGCGCGGG + Intergenic
1166382911 19:42364291-42364313 CCACGGGGGGGCAGTGGGGTGGG - Intronic
1166798083 19:45440022-45440044 GCGCGCGGGGGGAGCGGTGCTGG + Intronic
1167579631 19:50333877-50333899 CCGCGCAGGCGCAGTACCGCGGG - Intronic
1168056987 19:53869500-53869522 CCCCGCGGGGGCGGGGGTGCGGG - Exonic
1168294001 19:55370016-55370038 CCGAGCAGGGGCAGGGACGCAGG - Intronic
1168336523 19:55600350-55600372 GCGCGCGGGGGCAACGGGGCCGG - Intronic
924987729 2:287607-287629 CCGCGCGGAGGCGGCGGGGCTGG - Exonic
925405141 2:3601164-3601186 CGGCGTGGTGGCAGTGGAGCCGG + Intronic
929983187 2:46699483-46699505 CGGCGCGGGGGCCGGGGAGCAGG - Intronic
930867519 2:56136559-56136581 GCGGGCGGGGGCATTGGCGTTGG - Intergenic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
931681217 2:64751203-64751225 CGGGGCGGGGGCAGTGGAGTGGG + Intergenic
932591530 2:73070806-73070828 CGGCGCGGGGGCCCGGGCGCGGG + Intronic
934566987 2:95346619-95346641 CCCCGCGGGCGCCGGGGCGCGGG - Intronic
937950876 2:127387511-127387533 CCGCGCTGGGGCGGAGGGGCGGG - Intronic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938909901 2:135876338-135876360 CCTCGCGGCGGCAGCGGAGCCGG - Exonic
941808628 2:169734161-169734183 CCGGGCGCGGGCAGCGGGGCCGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942278195 2:174337444-174337466 CCGGGCGGCGGCAGCGGCGGCGG + Exonic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
943266561 2:185739123-185739145 GCGCCCGGGGGCGGTGGCGGTGG + Intronic
944273088 2:197804959-197804981 CCCAGCGGCGGCAGTGGCGGCGG - Exonic
948929440 2:241122700-241122722 CTGTGGGGGGGGAGTGGCGCCGG - Intronic
1169914970 20:10674731-10674753 CCGCGCCGGGGCAGAGGCGCGGG + Intergenic
1172083231 20:32358705-32358727 GCGGGCTGGGGCGGTGGCGCGGG - Exonic
1172284660 20:33732177-33732199 CCGCGGGGCGGGAGGGGCGCGGG + Intronic
1174317519 20:49713904-49713926 CCGAGCGGGCGCAGCGGCGGGGG + Intergenic
1174804583 20:53594142-53594164 GCGCACGGGGGCAAAGGCGCGGG + Intronic
1175267223 20:57710046-57710068 CCGCGCGGGGGCCGGGGAGGGGG + Intronic
1175847003 20:62064796-62064818 CGGCGCGGCGGCTGCGGCGCCGG - Exonic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1175988052 20:62773999-62774021 CCCCGAGGGGACAGTGGAGCAGG + Intergenic
1176281590 20:64316650-64316672 CCGCGCGGGGGTTGGGGCGCGGG + Intergenic
1176547803 21:8209003-8209025 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1176550006 21:8216980-8217002 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176555695 21:8253205-8253227 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1176568932 21:8400014-8400036 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176574629 21:8436237-8436259 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1176576846 21:8444249-8444271 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176611242 21:8987529-8987551 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1178274619 21:31225879-31225901 CCTCGCGACCGCAGTGGCGCAGG + Exonic
1178534891 21:33403322-33403344 CCGCGCGGGGGCGGTGGCCTCGG + Exonic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179626991 21:42654262-42654284 TCGCGCGGGGGCAGGTGCGGGGG + Intronic
1179820431 21:43934039-43934061 CAGGGCAGGGGCAGTGGAGCAGG + Intronic
1180154865 21:45972866-45972888 CCGGGCCGGGTCAGCGGCGCCGG + Intergenic
1180154877 21:45972900-45972922 CCGGGCCGGGTCAGCGGCGCCGG + Intergenic
1180187502 21:46146652-46146674 CAGCGATGGGGCAGTGGTGCTGG - Intronic
1180894353 22:19317746-19317768 CCGGCTGGGGGCAGTGGCTCAGG - Intergenic
1181068901 22:20320454-20320476 CCGCGGCCGAGCAGTGGCGCTGG + Intergenic
1182222980 22:28773102-28773124 GCGGGCGCGGGCAGGGGCGCGGG + Intronic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1183441304 22:37824650-37824672 CCGGGCGCGGGACGTGGCGCGGG + Intronic
1183720131 22:39557771-39557793 CCGGGCCGGGGCGGGGGCGCGGG - Intergenic
1184465896 22:44668767-44668789 CTGCGCGGTGGCAGCGGCGGCGG + Intronic
1185083246 22:48721263-48721285 TGGCACGGGGGCAGTGGCCCAGG - Intronic
1185287837 22:50010465-50010487 CTGCAGGGGGGCAGTGGCGTGGG + Intronic
1185413506 22:50697787-50697809 CCGGGCCGGGGCAGTGGCTCTGG + Intergenic
1203252677 22_KI270733v1_random:125288-125310 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1203254896 22_KI270733v1_random:133306-133328 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203260733 22_KI270733v1_random:170374-170396 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1203262952 22_KI270733v1_random:178385-178407 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
950584020 3:13880181-13880203 TCCCGCGGGCGCAGGGGCGCTGG - Intergenic
951323215 3:21271880-21271902 CTGCCCGGGGCCAGTGGCGCCGG + Intergenic
951551892 3:23882794-23882816 CTGCCTGGGGCCAGTGGCGCCGG + Intronic
953055258 3:39382853-39382875 CAGGCCGGGGGCAGTGGCCCAGG - Intergenic
953748784 3:45594353-45594375 ACGCGCGGCGGCTGAGGCGCAGG - Intronic
953981972 3:47417800-47417822 CAGCGCCGGGACAGTGGCGTGGG - Exonic
954198040 3:49007815-49007837 CCGCGCGGAGGCGGAGGCGGAGG + Intronic
954256531 3:49411577-49411599 CCGGGCGGGGGAAGGGGCACAGG + Intronic
954437310 3:50503110-50503132 CCGCGCCAGGGCAGAGGCGCTGG - Intronic
954688519 3:52383616-52383638 CTGCGCTGGGGCAGCGGAGCTGG + Intronic
954743169 3:52770829-52770851 CCGAGAGGGGGCAGTGGGGGCGG + Exonic
955003827 3:54951458-54951480 CGGCCCGGGGGCAGTGGGGTGGG + Intronic
956459210 3:69454539-69454561 CTGCCCGGGGCCGGTGGCGCCGG - Intronic
959539838 3:107525153-107525175 CCGCGCGGGGACGTCGGCGCCGG - Intronic
960939860 3:122926480-122926502 CCGGGCGGGAGCAGTTGAGCCGG + Exonic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
961858250 3:129893668-129893690 CCGCGCCGGGGCTGAGGCGGCGG - Intergenic
963236726 3:142963615-142963637 CCGCGCTGCGGCAGCGGCGGCGG + Exonic
965590547 3:170357347-170357369 GCGCGCGGGGCCAGAAGCGCCGG + Intergenic
966201926 3:177366718-177366740 CCGGCTGGGGGCAGTGGCTCAGG + Intergenic
966866534 3:184261497-184261519 CCGGGCGGGGGCGGGGGCGGGGG + Intronic
967055358 3:185825129-185825151 CCGCCCGGGGGCAGAGGCGGAGG + Intergenic
967870364 3:194224269-194224291 CAGAGCCGGGGCAGTGGGGCTGG - Intergenic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968583233 4:1404458-1404480 CTGCGCAGGGGCCGAGGCGCGGG - Intronic
968647361 4:1747431-1747453 CCGGGCGGGGGCCCTGGCACTGG + Intergenic
968701208 4:2059100-2059122 ACGGGCGGGGGCGGCGGCGCGGG - Intergenic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
969714278 4:8860949-8860971 CCGGGCGGGGGCGGGGGCGAGGG + Intronic
969715741 4:8867404-8867426 CCGGGGGGTGGCCGTGGCGCCGG + Exonic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
974069341 4:57110122-57110144 CCGTGCGGGGGTGGCGGCGCCGG - Exonic
974089897 4:57300427-57300449 CTGCTCGGGGCCAGTGGCACGGG + Intergenic
976765224 4:88592243-88592265 CGGCGCGGGGACAGCGGCACGGG - Intronic
980115207 4:128672765-128672787 CTGCCCGGGGGCAGCGGGGCGGG - Intergenic
982184187 4:152779716-152779738 GCGCGCGGGGCCAGAGGCACCGG - Exonic
983649797 4:170026516-170026538 GCGGGCGGGGGCAGCGGGGCGGG + Intronic
984811091 4:183797349-183797371 CCCCGCGGGGGCGGAGACGCGGG - Intergenic
985462693 4:190121836-190121858 CGGGGCGGGGGGCGTGGCGCAGG - Intergenic
986200298 5:5573200-5573222 CCCCGCGGGGGCACTGGCCTCGG - Intergenic
986402792 5:7396050-7396072 CCGCGCGGTGGCGGTGGCGGCGG + Intergenic
987084485 5:14456127-14456149 CTGCCTGGGGCCAGTGGCGCTGG + Intronic
988020531 5:25614813-25614835 CTGCCCAGGGCCAGTGGCGCTGG + Intergenic
989484135 5:41968368-41968390 CCGAGCGCGGGCACCGGCGCGGG - Intergenic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
991330237 5:65485689-65485711 CTGCCCGGGGCCAGTGGGGCCGG + Intergenic
992866330 5:80960548-80960570 GCGCGCGGTGGCAGGGGCGCGGG - Intergenic
996379045 5:122845523-122845545 CCCCGCGGGCGCAGCGGGGCGGG + Exonic
1001065049 5:168529523-168529545 TCGCGCGGGGGCGGTGGGGGCGG + Exonic
1001945319 5:175773321-175773343 CGGCGCGGGGGAAGCGGGGCCGG - Intergenic
1002438820 5:179253360-179253382 CCGGCCGGGCGCAGTGGCTCAGG + Intronic
1002616437 5:180459272-180459294 CTGCCCGGGGCCGGTGGCGCCGG - Intergenic
1004391021 6:15209828-15209850 CCAGGCGGGTGCAGTGGCTCAGG - Intergenic
1004607381 6:17206695-17206717 CTGCGCAGGGCCAGTGGCACTGG + Intergenic
1005987558 6:30884205-30884227 CCGGCCGGAGGCAGCGGCGCGGG + Intronic
1006472724 6:34237522-34237544 CGGCGCGGGGGAAGGGGTGCGGG - Intronic
1006472950 6:34238244-34238266 GCGCGCGGGGGGAGGGGCGCAGG - Intronic
1006710822 6:36068730-36068752 GAGGGCGGGGGCAGTGGTGCTGG + Intronic
1006717594 6:36130451-36130473 CCGCGCGAGGGCGGGGGCCCCGG - Exonic
1010187153 6:73157423-73157445 CCGCCCGGGGGCGGGGGCGGTGG + Intronic
1010244795 6:73653511-73653533 CCGGGCGGGGGCGGGGGCGGGGG - Intronic
1012450664 6:99349854-99349876 CCGCGCGCGGGCAAGGGCGGCGG + Intronic
1013480791 6:110551041-110551063 CCGGGAGAGGGCAGTGGCGCTGG - Intergenic
1014137571 6:117907310-117907332 GCGCGCGGCGGCAGTTGTGCTGG - Intergenic
1017163847 6:151390516-151390538 CGGCGCCGGGGCTGTTGCGCCGG - Intronic
1019111924 6:169724006-169724028 CCGCGCGGCGGCGGCGGCGGCGG - Exonic
1019406170 7:885423-885445 CCGCACGGGGACAGAGGCACGGG - Intronic
1019828225 7:3301269-3301291 CCGGGCGGGGGCGGCGGCGGCGG + Intergenic
1020011606 7:4808641-4808663 ACGCGGAGGGGCAGTGGCGTTGG - Intronic
1020011628 7:4808719-4808741 ACGCGGAGGGGCAGTGGCGTTGG - Intronic
1020011654 7:4808819-4808841 ACGCGGAGGGGCAGTGGCGTCGG - Intronic
1020011661 7:4808848-4808870 ACGCGGAGGGGCAGTGGCGTTGG - Intronic
1020011675 7:4808898-4808920 ACGTGGGGGGGCAGTGGCGTCGG - Intronic
1020011697 7:4808976-4808998 ACGCGGGGGGGCAGTGGCGTTGG - Intronic
1020274373 7:6615701-6615723 CCGCGCGGGGGCCGGGGCGGGGG - Exonic
1021231105 7:18086900-18086922 CCGCGCGGCGGCGGCGGCGGCGG + Intergenic
1021827942 7:24573356-24573378 GCGCGCGGAGGCAGCGGCGGGGG + Exonic
1022008876 7:26291987-26292009 GCGCGCGGCGGCAGCGGCGGCGG - Exonic
1022310899 7:29194872-29194894 CCGGGCGAGGGCAGCGGCGGCGG + Exonic
1022410422 7:30135358-30135380 CCGCGCGGGAGCTCGGGCGCAGG - Intronic
1023836642 7:44072528-44072550 CAGCTCGGGGCCAGTGGGGCTGG + Exonic
1029552528 7:101245001-101245023 GCTCGCGGGGGCAGTGGCCATGG - Exonic
1029809633 7:103034460-103034482 CTGCCCGGGGCCAGTGGGGCCGG + Intronic
1031599747 7:123692525-123692547 CCAGGCGGGGGCGGTGGCCCAGG + Exonic
1032344295 7:131105744-131105766 CCGCGCGGGTGCCCCGGCGCTGG - Intergenic
1033403830 7:141052886-141052908 CCGAGCTGGGGCAGTGGAGAGGG - Intergenic
1035643568 8:1201344-1201366 CCGCTCAGGGGCCGTGGGGCAGG + Intergenic
1036578827 8:10054400-10054422 CCGGGGGGCGGCAGGGGCGCGGG - Exonic
1040701771 8:50074964-50074986 CTGCCTGGGGCCAGTGGCGCCGG - Intronic
1041690409 8:60680435-60680457 CCGGGCGGGGGTGGGGGCGCTGG + Intronic
1042271916 8:66963122-66963144 CCCCGCGGGGGCAGCGGAGGCGG - Intergenic
1042604129 8:70528950-70528972 CTGAGCTGGGGCAGTGGCTCTGG + Intergenic
1049376085 8:142289857-142289879 CCGGGCAGGCGCAGTGGGGCTGG + Intronic
1049554427 8:143275024-143275046 CCACGTGGGGCCACTGGCGCAGG - Intronic
1049639891 8:143710744-143710766 ATGCGCGGGTGCAGTGGGGCTGG - Intronic
1049697226 8:143990259-143990281 CCGCGTGGGGGCGGGGGCGGGGG - Exonic
1049798044 8:144505506-144505528 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798061 8:144505548-144505570 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798079 8:144505590-144505612 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798097 8:144505632-144505654 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1052756798 9:32550620-32550642 CCGCTCGGGGGCCCTGGCCCTGG + Intronic
1052903792 9:33817217-33817239 CTGCGCGGGGGGAGGGGCGACGG - Intergenic
1053066469 9:35072548-35072570 CCGCGAGGTGGCAGTGGCAGTGG + Exonic
1053697398 9:40650737-40650759 CCGGGCGGGGGCCGCGGCGGCGG + Intergenic
1054308703 9:63450183-63450205 CCGGGCGGGGGCCGCGGCGGCGG + Intergenic
1054489440 9:65762644-65762666 CCGGGCGGGGGCCGCGGCGGTGG - Intergenic
1055654924 9:78442177-78442199 CTGCCCCGGGGCGGTGGCGCCGG - Intergenic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1056677253 9:88686173-88686195 CTGCCCGGGGCTAGTGGCGCCGG + Intergenic
1057259668 9:93576677-93576699 CCGCGCGGGGGCGGCGGGGGCGG - Exonic
1057490473 9:95516301-95516323 GCGCGCCGGGGCCGTGGAGCCGG - Intronic
1058838355 9:108880004-108880026 ACGTGCGGGGGCAGTGGGGTTGG - Intronic
1059451054 9:114371758-114371780 CCGCGCTGGGGATGTTGCGCTGG - Intronic
1061252689 9:129436016-129436038 CAGCGCTGGGGCAGGGGGGCGGG - Intergenic
1061363320 9:130157323-130157345 CCAGGCGGGGGCAGAGGCTCAGG + Intergenic
1061967751 9:134025613-134025635 GCGCGCGGGGTCTGGGGCGCGGG + Intergenic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062458665 9:136653581-136653603 CGGGGCGGGGGCTGTGGCGTGGG + Intergenic
1062579276 9:137222314-137222336 CCGCGCGGGGTCCGCGGGGCGGG + Intergenic
1062653543 9:137590473-137590495 GCGCGCGGTGGCGGTGGCGGCGG - Exonic
1203469080 Un_GL000220v1:108439-108461 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1203471297 Un_GL000220v1:116451-116473 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203476901 Un_GL000220v1:152411-152433 CCGGGCGGGGGCGGGCGCGCCGG + Intergenic
1203479118 Un_GL000220v1:160423-160445 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1187181449 X:16946910-16946932 GCGGGCGGGGGCTGTGGCTCCGG + Exonic
1187281418 X:17860898-17860920 CCGGGCGGGGGCGGGGACGCGGG - Intronic
1188004149 X:25005740-25005762 CCGCTTGGAGGCGGTGGCGCTGG - Intronic
1189005129 X:36986446-36986468 CGGAGCGGGAGGAGTGGCGCGGG - Intergenic
1189043894 X:37571496-37571518 CGGAGCGGGAGGAGTGGCGCGGG + Intronic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1190325545 X:49204963-49204985 CCGTGTGTGGGCAGTGGCTCAGG + Intergenic
1190745889 X:53321440-53321462 CCGGGTGGGGGCAGGGGCGGGGG - Intergenic
1192795508 X:74421764-74421786 TCGGGCGGGGGCACTGGCACGGG - Exonic
1196860877 X:120026044-120026066 CTGCCCGGGGCCAGTGGCGCTGG + Intergenic
1200229487 X:154437007-154437029 CCGCGCTGGTGCTGTGGCCCGGG + Exonic
1200745052 Y:6896892-6896914 CCAAGCAGGGGCAGTGGGGCTGG + Intergenic