ID: 970192536

View in Genome Browser
Species Human (GRCh38)
Location 4:13529709-13529731
Sequence GTCCCCACCCTAGGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970192524_970192536 13 Left 970192524 4:13529673-13529695 CCCTGTGGGATTCTCCCCTCCTC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192526_970192536 -1 Left 970192526 4:13529687-13529709 CCCCTCCTCTTCCCACAGCCTAG No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192529_970192536 -6 Left 970192529 4:13529692-13529714 CCTCTTCCCACAGCCTAGTCCCC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192518_970192536 26 Left 970192518 4:13529660-13529682 CCCTTCCCCGCACCCCTGTGGGA No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192520_970192536 21 Left 970192520 4:13529665-13529687 CCCCGCACCCCTGTGGGATTCTC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192519_970192536 25 Left 970192519 4:13529661-13529683 CCTTCCCCGCACCCCTGTGGGAT No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192522_970192536 19 Left 970192522 4:13529667-13529689 CCGCACCCCTGTGGGATTCTCCC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192527_970192536 -2 Left 970192527 4:13529688-13529710 CCCTCCTCTTCCCACAGCCTAGT No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192523_970192536 14 Left 970192523 4:13529672-13529694 CCCCTGTGGGATTCTCCCCTCCT No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192525_970192536 12 Left 970192525 4:13529674-13529696 CCTGTGGGATTCTCCCCTCCTCT No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192528_970192536 -3 Left 970192528 4:13529689-13529711 CCTCCTCTTCCCACAGCCTAGTC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data
970192521_970192536 20 Left 970192521 4:13529666-13529688 CCCGCACCCCTGTGGGATTCTCC No data
Right 970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970192536 Original CRISPR GTCCCCACCCTAGGAGTGGG AGG Intergenic
No off target data available for this crispr