ID: 970194471

View in Genome Browser
Species Human (GRCh38)
Location 4:13541640-13541662
Sequence TCTCCAGGAGTTGCCGCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970194464_970194471 15 Left 970194464 4:13541602-13541624 CCAGCAGGCCTGAAATTCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 192
Right 970194471 4:13541640-13541662 TCTCCAGGAGTTGCCGCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 76
970194467_970194471 7 Left 970194467 4:13541610-13541632 CCTGAAATTCTGAGGATTCAGGC 0: 1
1: 0
2: 0
3: 18
4: 293
Right 970194471 4:13541640-13541662 TCTCCAGGAGTTGCCGCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 76
970194463_970194471 16 Left 970194463 4:13541601-13541623 CCCAGCAGGCCTGAAATTCTGAG 0: 1
1: 0
2: 2
3: 12
4: 198
Right 970194471 4:13541640-13541662 TCTCCAGGAGTTGCCGCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970194471 Original CRISPR TCTCCAGGAGTTGCCGCTCA GGG Exonic
900504207 1:3021213-3021235 ACCCCAGAAGTTGCAGCTCAGGG + Intergenic
901124023 1:6916710-6916732 CCTCCAGGAGTTGGCACTCTAGG + Intronic
902451526 1:16499424-16499446 TCACCAGGCGTTTCCGCCCAGGG - Intergenic
906477860 1:46181948-46181970 TCTCCAGGATTTACGCCTCATGG - Intronic
906925313 1:50109630-50109652 TATCCAGGAGCTGCCTCTCGAGG - Intronic
914325314 1:146609130-146609152 TGTCCTGGAGTTGCCACTCCTGG - Intergenic
914717664 1:150265774-150265796 TCTCCTCGAGTTGCTCCTCATGG - Exonic
923208546 1:231781800-231781822 TCTCCCAGAGTTTCAGCTCAAGG - Intronic
1063109444 10:3021858-3021880 TTTCCGGGAGCTGCCACTCATGG + Intergenic
1071597987 10:86942064-86942086 CCTCCAGGCTATGCCGCTCACGG + Intronic
1072725041 10:97807480-97807502 GCTCCAGGAGGGGCCACTCAGGG + Intergenic
1072755003 10:98013817-98013839 TCTACAGTAGTTGCCTCACAAGG + Intronic
1078851455 11:15167861-15167883 GCTGCAGGAGTTGCCTTTCACGG - Intronic
1080120148 11:28667703-28667725 TCTGCAGGAGTTCCTGCTCCTGG + Intergenic
1080689790 11:34546841-34546863 TCTCCAGGTGTTGGTGCCCATGG - Intergenic
1083815361 11:65129820-65129842 CCTCCAGGTGCTGCCGCTCATGG + Exonic
1089739671 11:120573778-120573800 GCTCCAGGATTTGGGGCTCAGGG + Intronic
1090453721 11:126829068-126829090 TATCCAGAAGTTACTGCTCAGGG - Intronic
1091653169 12:2324567-2324589 GCTCCAGCAGGTGCAGCTCAGGG - Intronic
1091928286 12:4373552-4373574 TCTCCAGGTGCAGCCCCTCATGG + Intronic
1098064544 12:66599681-66599703 TCTCCATGACTTTACGCTCAAGG - Intronic
1100875573 12:98957908-98957930 TCTCTAGGAGTTGCAACTGAGGG - Intronic
1104316069 12:127702753-127702775 TCTCCAGCAGCTGCAGCTCCTGG - Intergenic
1106394435 13:29366780-29366802 CCTCCAGTAGTTGCCTGTCAAGG + Intronic
1112229230 13:97570920-97570942 ATTCCAGGACTTGCCTCTCAAGG - Intergenic
1123806729 15:23881447-23881469 ACTCCAGCAGTTGCCGCTTCTGG + Intergenic
1127174846 15:56342770-56342792 TCTCCAGGAGCTGCCACTTTGGG - Intronic
1129457854 15:75685222-75685244 TCTCCAGGAGAAGGCGCTGAGGG + Exonic
1131091844 15:89629447-89629469 TCTCCAGGCGCTGCCGCTCCAGG + Exonic
1135494827 16:22942289-22942311 TCTCCAGGAGTTGCTTCCCCTGG - Intergenic
1140008247 16:71101817-71101839 TGTCCTGGAGTTGCCACTCCTGG + Intronic
1141101236 16:81198926-81198948 TCTCCAGGCGGTGCCTCCCAGGG + Intergenic
1142692049 17:1612527-1612549 TCTCCGGGAGCTTCGGCTCATGG - Intronic
1148637914 17:49163332-49163354 TCTCTAGGAGTTGCAGATGATGG + Intronic
1150756626 17:67920405-67920427 TCTCCAGGAGCTGCTGGTCTGGG - Intronic
1152649050 17:81483539-81483561 TCTCCTCCAGCTGCCGCTCAGGG + Intergenic
1152700362 17:81815461-81815483 CCTCCAGCAGGTGCAGCTCAGGG - Intergenic
1153614827 18:6924739-6924761 CTTCCAGGAGTTTCCACTCATGG + Intergenic
1160593102 18:79955133-79955155 TATCCAGGAGTTTCTGCTCTGGG - Intergenic
925616162 2:5746344-5746366 GCTCCAGGCGCTGCCACTCATGG - Intergenic
926863605 2:17335577-17335599 TCTCCAGGGATTTCCTCTCAAGG - Intergenic
930640097 2:53845588-53845610 GCTCCAGGAGTAGCCACTAAAGG - Intergenic
941984015 2:171491709-171491731 GCTCCAGGAGTTGCTGGTAAAGG + Intergenic
946619827 2:221548925-221548947 ACACCAGGATTTACCGCTCAGGG + Intronic
948592046 2:239056655-239056677 TCTCCAGGAGGTGGGGCTTAAGG + Intronic
1171363363 20:24606346-24606368 TGTTCATGAGTTGTCGCTCATGG - Intronic
1175664627 20:60847931-60847953 TCTCCAGGATCTGCCACTCCTGG + Intergenic
1183683991 22:39351055-39351077 TTTCCATGAGGTGCCACTCAAGG - Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
950446951 3:13043960-13043982 AGTCCAGGAGCTGCTGCTCAGGG + Intronic
956334624 3:68149478-68149500 TCTCAAGGAGCTTCCACTCATGG + Intronic
960699298 3:120425107-120425129 TCTCCAGGAGATGCAGCACATGG + Intronic
961667746 3:128504231-128504253 TCTCCAGGCTTTGCAGCTCCCGG + Intergenic
970194471 4:13541640-13541662 TCTCCAGGAGTTGCCGCTCAGGG + Exonic
975798250 4:78032064-78032086 CTTGCAGGAGTTGCTGCTCAAGG + Intergenic
980113777 4:128659708-128659730 CTTCCAGGAGTTGCTGCTCAAGG + Intergenic
984290863 4:177792269-177792291 TCTCAAGGAGCTTCCACTCATGG + Intronic
986284860 5:6351678-6351700 TCTCCAGGGAGTGCGGCTCATGG - Intergenic
987886309 5:23817635-23817657 ACTCCTGGAGATGCCGCTTAGGG - Intergenic
992190251 5:74285034-74285056 GATCCAGGAGTTGCAGCTCTAGG - Intergenic
995884910 5:116883486-116883508 TTTCCAGGAGCTGACACTCAGGG + Intergenic
1010373702 6:75141412-75141434 TCTCCAGGAGCTGCAGCAGACGG + Intronic
1023754979 7:43407876-43407898 TCTCCAGGGGTTGCAACTCAGGG + Intronic
1024316558 7:48024676-48024698 TCTCCAGCTGCTTCCGCTCATGG + Intronic
1029444763 7:100605758-100605780 CCTCCGGGAGTCGTCGCTCACGG - Exonic
1031635976 7:124101372-124101394 TCTCCAGGAGATGGCGCTCACGG + Intergenic
1032719934 7:134542522-134542544 TCTACTGGAGATGCCGCTCAAGG - Intergenic
1032724828 7:134580937-134580959 TCTACTGGAGATGCCACTCAAGG - Intergenic
1035640556 8:1181846-1181868 TCTCCAGGGGGTGCCGTGCAGGG - Intergenic
1035847461 8:2880726-2880748 TCTGCAGGAATTGGGGCTCAGGG + Intergenic
1038279440 8:26150448-26150470 TCTGCAGAAGTTTCTGCTCATGG + Intergenic
1039843631 8:41310315-41310337 TCTCCAGGTGGGGCCGCCCATGG + Intergenic
1043176979 8:77033857-77033879 TCTTCAGGAGCTGCTGCTCCAGG + Intergenic
1048119513 8:131563794-131563816 TCCCTAGGAGGTGCCACTCATGG + Intergenic
1049246413 8:141565178-141565200 TCCCCAGGAGCTGCAGCTGAGGG + Intergenic
1049657716 8:143806075-143806097 TCTCCAGGAGGGGCCGCTCCTGG - Intronic
1053833095 9:42105279-42105301 ACTACAGGTGTTGCCTCTCATGG - Intronic
1054597457 9:67082130-67082152 ACTACAGGTGTTGCCTCTCATGG + Intergenic
1055290189 9:74774642-74774664 ACTCCAGGAGTTTCAGCTAAGGG - Intronic
1056767547 9:89454341-89454363 TCTCCAGGAGTGGCCACAGAAGG + Intronic
1056989805 9:91400145-91400167 TCCTCGGGAGTTGGCGCTCACGG + Intergenic
1058130480 9:101247189-101247211 CTTCCAGGAGCTGCTGCTCATGG - Intronic
1196891024 X:120291097-120291119 TCTCAAGGAGTTGGCAGTCAAGG - Intronic
1198434075 X:136598277-136598299 GCTCCAGGGTTTGCCCCTCAAGG + Intergenic
1201350922 Y:13040357-13040379 TCTCAAGGAGCTTCCACTCACGG + Intergenic