ID: 970194772

View in Genome Browser
Species Human (GRCh38)
Location 4:13543087-13543109
Sequence GAGCCGAGGCCTTAGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970194768_970194772 11 Left 970194768 4:13543053-13543075 CCTGGGATTGCTGTGAGAGACAT 0: 1
1: 0
2: 0
3: 6
4: 172
Right 970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG No data
970194765_970194772 21 Left 970194765 4:13543043-13543065 CCCTCAGCCGCCTGGGATTGCTG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG No data
970194766_970194772 20 Left 970194766 4:13543044-13543066 CCTCAGCCGCCTGGGATTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 222
Right 970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG No data
970194767_970194772 14 Left 970194767 4:13543050-13543072 CCGCCTGGGATTGCTGTGAGAGA 0: 1
1: 0
2: 0
3: 34
4: 254
Right 970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970194772 Original CRISPR GAGCCGAGGCCTTAGATGAG AGG Intronic
No off target data available for this crispr