ID: 970195133

View in Genome Browser
Species Human (GRCh38)
Location 4:13544633-13544655
Sequence CTGGCTCTGGATTCGGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970195133_970195143 30 Left 970195133 4:13544633-13544655 CCTCCCCCCGAATCCAGAGCCAG 0: 1
1: 0
2: 0
3: 11
4: 215
Right 970195143 4:13544686-13544708 TCTCATCGCTTCTCGCCCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 55
970195133_970195141 3 Left 970195133 4:13544633-13544655 CCTCCCCCCGAATCCAGAGCCAG 0: 1
1: 0
2: 0
3: 11
4: 215
Right 970195141 4:13544659-13544681 CTCTCCTTTCGCAGCTCAGCTGG 0: 1
1: 0
2: 3
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970195133 Original CRISPR CTGGCTCTGGATTCGGGGGG AGG (reversed) Exonic
900189121 1:1345892-1345914 CTGGCTCTGGGGTCAGGGGTTGG - Intronic
900367311 1:2316464-2316486 CTGGCTCTGGTTGCCGTGGGCGG + Intergenic
900415968 1:2534828-2534850 CTGGCTGCTGATGCGGGGGGTGG - Intergenic
900423729 1:2566789-2566811 CTGGCCCTGAGTTCGTGGGGAGG - Intergenic
902723879 1:18322716-18322738 CAGGCTCTGGGTTCAGGGGTGGG - Intronic
902735391 1:18397456-18397478 CTGGATCAGAATTCAGGGGGTGG - Intergenic
902797976 1:18811705-18811727 CTGGCTGTGGAATCGGGGAGTGG - Intergenic
902984741 1:20148613-20148635 CTGGTTCTGGACTGGGTGGGAGG + Exonic
903396629 1:23006582-23006604 ATTGCTCTGGGTTTGGGGGGCGG - Intergenic
905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG + Exonic
907184892 1:52602195-52602217 CTGGCTCTGGGGTCCGGGGCAGG + Intergenic
907302565 1:53497727-53497749 CTGGCTCTGGAGGCAGGGCGTGG - Intergenic
911096844 1:94061973-94061995 CTGAATATGGATTTGGGGGGTGG - Intronic
913199470 1:116484254-116484276 CTGCCTCTGGACTCTGGGGAGGG + Intergenic
916707174 1:167363048-167363070 CTGGTTCTGCCTTGGGGGGGAGG - Intronic
917484569 1:175444022-175444044 CTGGCCATGGACTTGGGGGGTGG + Intronic
922766701 1:228159761-228159783 CTGGGTCTGAATTAGGGAGGAGG - Exonic
923211791 1:231810196-231810218 CTGGCTCTGTACTGGGTGGGTGG + Intronic
1063860931 10:10307148-10307170 CTGGCTCTGTGTTTGGAGGGAGG + Intergenic
1064647213 10:17471913-17471935 ATGGCTCTGGATTTAGCGGGTGG + Intergenic
1064920322 10:20509616-20509638 ATGGCTCTGGATTCTGGTGAGGG - Intergenic
1065727332 10:28678186-28678208 CTGGCTCTGCCTGCGGGGAGCGG + Intronic
1066436051 10:35397516-35397538 TTGGCCCTGGATTGGGGAGGAGG + Intronic
1067797281 10:49329783-49329805 CTTGCTCTGGCTTCAGGGGTTGG + Intergenic
1069463625 10:68618068-68618090 CTGGCTTTGAATTTTGGGGGTGG + Intronic
1073026290 10:100489444-100489466 ATGGCTCTGGTTTTGGGGAGTGG + Intronic
1075028196 10:119002454-119002476 CTGCCACTTGATTCTGGGGGTGG + Intergenic
1075678721 10:124317011-124317033 CTGTCTCTTGATCCGGGGGCTGG + Intergenic
1076721315 10:132394624-132394646 CTGACCCTGTATTCGGGGGTTGG - Intergenic
1077327305 11:1969348-1969370 CTGGGACTGCATTCCGGGGGAGG - Intronic
1081575740 11:44317642-44317664 CTGGCTCTGGAGAGTGGGGGAGG + Intergenic
1083853480 11:65380723-65380745 CTGGTTCTGGAGTTTGGGGGAGG + Intronic
1084063092 11:66688226-66688248 CTGGCTGTGGGTTCGGGAGCAGG + Exonic
1084507965 11:69581482-69581504 CTGGCACTGGCAGCGGGGGGTGG + Intergenic
1088965707 11:114719247-114719269 CTGGGTTTGGATTGGGAGGGAGG - Intergenic
1089174293 11:116537231-116537253 CTTGCTCTGGCTTTGGGGTGGGG + Intergenic
1089565771 11:119370843-119370865 TTGGCCCTGGAGCCGGGGGGAGG + Intronic
1090187703 11:124749037-124749059 CTGGCAATGGAGTCGGGGTGGGG + Intronic
1090971781 11:131650056-131650078 CTGCCTCTGGTTTCTGGAGGAGG + Intronic
1091228856 11:133974866-133974888 CTGCCCCGGGATTCTGGGGGTGG - Intergenic
1202810287 11_KI270721v1_random:24528-24550 CTGGGACTGCATTCCGGGGGAGG - Intergenic
1095472704 12:42553508-42553530 TTGGCTCTAGAATCAGGGGGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097186285 12:57198192-57198214 CTGGCTGTGGACTGGGTGGGTGG + Exonic
1101334005 12:103780147-103780169 CTGATTCTGGATCCTGGGGGAGG + Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102501596 12:113356903-113356925 CTTGCTCTGGAGGCGGGCGGTGG - Intronic
1102676848 12:114665182-114665204 CGGGCTCTGGTTTCGGGTTGGGG - Intergenic
1102676921 12:114665422-114665444 CAGCCTCTGGAATCGGGGGGCGG - Intergenic
1103705457 12:122868909-122868931 CTGTGTCTGGATCTGGGGGGTGG - Intronic
1103968599 12:124655613-124655635 CTGGGCCTGGGGTCGGGGGGAGG - Intergenic
1107630833 13:42341523-42341545 CTGGCTCTGGAGTGGGGGTGAGG + Intergenic
1108999074 13:56773306-56773328 CTGCCTCTGGCTTCGTGTGGAGG + Intergenic
1110630203 13:77698211-77698233 CTGGCGCTGGGCGCGGGGGGCGG + Intronic
1113200698 13:107865999-107866021 CAGGAACTGGAGTCGGGGGGCGG - Exonic
1114629071 14:24147689-24147711 CTGCCTCAGGATGCCGGGGGAGG + Exonic
1115789559 14:36863855-36863877 CTGGGTCTGTATTCAGTGGGAGG + Intronic
1116256168 14:42559349-42559371 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1118716439 14:68563392-68563414 TGGGCTCTGGACTTGGGGGGCGG - Intronic
1118995988 14:70836525-70836547 CTGGCTCTGGCTTCAGGTGAAGG + Intergenic
1119411097 14:74431039-74431061 CTGGCTCTGGCTTCAAGGGCAGG - Intergenic
1119640406 14:76310362-76310384 CGGGCTCAGGATCCGGAGGGGGG + Intergenic
1120488367 14:85144895-85144917 CTGTCTCTGGATGTGGGGTGGGG - Intergenic
1121179527 14:91918298-91918320 GTGGCTCTGGATTTGTGGGAAGG + Intronic
1122354584 14:101115202-101115224 CTGGCTCTGGACTGGATGGGAGG - Intergenic
1122479894 14:102040304-102040326 CAGGCCCTGGATCCTGGGGGTGG - Exonic
1123147150 14:106142844-106142866 CTGTCTCTGGATTCCAGGGAGGG + Intergenic
1126988842 15:54346679-54346701 CTGGCTCTGCACTCGGTAGGTGG + Intronic
1127932600 15:63606867-63606889 TTTGCTCTGGACTCGGGGGCAGG - Intergenic
1129471620 15:75758673-75758695 GTGGCTCCGGAAACGGGGGGAGG + Intergenic
1132404650 15:101535123-101535145 CAGGCCCTGGAGTCGGGGTGAGG + Intergenic
1132719112 16:1307316-1307338 CAGGGACTGGATTCTGGGGGAGG + Intergenic
1135550399 16:23393305-23393327 ATGGCTCAAGATTCAGGGGGAGG + Exonic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1136451893 16:30358311-30358333 CTGGCTCTGCGGACGGGGGGCGG + Exonic
1136691789 16:32038227-32038249 CTGTCTCTGGATTCCAGGGAGGG - Intergenic
1136792377 16:32981790-32981812 CTGTCTCTGGATTCCAGGGAGGG - Intergenic
1136877440 16:33872118-33872140 CTGTCTCTGGATTCCAGGGAGGG + Intergenic
1138250827 16:55500616-55500638 CTGGCTCTGGCTTTGGGAGGTGG - Intronic
1138458570 16:57134719-57134741 CTGGGTCTGGGTTTGGGGGCGGG + Intronic
1138970544 16:62137815-62137837 CTTGCTCTACATTTGGGGGGTGG - Intergenic
1140644728 16:77017242-77017264 TTGGCTCTGCATTTGAGGGGTGG - Intergenic
1140808072 16:78551995-78552017 CTGGCTCTTGGTTGGGGGGTGGG + Intronic
1203094583 16_KI270728v1_random:1243254-1243276 CTGTCTCTGGATTCCAGGGAGGG - Intergenic
1143097598 17:4486646-4486668 CTGGCCAGGGATTCAGGGGGTGG - Intronic
1144654922 17:17029329-17029351 CTGGCTCTGGGTCTGGGGGGTGG - Intergenic
1145159966 17:20567657-20567679 CTGGCTCTGGGTCTGGGAGGTGG + Intergenic
1146336800 17:31979434-31979456 CTAGCTATGGAATCGGGGTGGGG - Intronic
1146572902 17:33968276-33968298 CTGGCTTTGGAATTGGGGGTTGG - Intronic
1147437101 17:40423255-40423277 GTGGCTCTGGATTTGGGGTTTGG + Intergenic
1149452213 17:56758692-56758714 CAGGCTGTGGCTTCGGAGGGTGG + Intergenic
1150788849 17:68184126-68184148 CTGCCTGTGTATTCGGGGGCTGG + Intergenic
1152123473 17:78432906-78432928 CTGGCACCGGGGTCGGGGGGGGG - Intronic
1152422573 17:80202042-80202064 CTGGCACTGGAGTCAGTGGGTGG - Intronic
1152496943 17:80679972-80679994 CTCTCTCTGGACTCTGGGGGAGG - Intronic
1152785913 17:82248028-82248050 CTGGCTCTGGGCTTGTGGGGAGG - Intronic
1152858090 17:82677647-82677669 CTGGCCCTGGAGACGGGTGGTGG - Intronic
1156668092 18:39432926-39432948 CTGGCTTTGGATTTGAAGGGTGG - Intergenic
1157580855 18:48773471-48773493 CTGGCTCTGGCTGGTGGGGGTGG - Intronic
1157892714 18:51433312-51433334 CTGGCCCTGGATTGGGGTGTTGG - Intergenic
1160799789 19:962454-962476 CTGGCTCTGCAGTGGGCGGGAGG - Intronic
1160953425 19:1678753-1678775 GTGGCTCCGGAGTCAGGGGGAGG - Intergenic
1161123766 19:2544695-2544717 GTGGCTCTTAATTGGGGGGGTGG + Intronic
1161304267 19:3557951-3557973 CGGGCTCTGGATTTGGGGTTGGG + Intronic
1161425060 19:4198617-4198639 CCGGGTCTGGAATGGGGGGGTGG - Intronic
1161943188 19:7418661-7418683 CTGGCTCTGGATCTCGGAGGTGG + Intronic
1161960840 19:7522379-7522401 CTGGCACCGGATTCGGGGCATGG + Intergenic
1161980085 19:7625841-7625863 GGGGCTCTGGGTTCGGGGCGGGG - Intronic
1162389328 19:10379959-10379981 CAGGCCCTGGATTGGGGGGATGG - Intronic
1162547045 19:11337136-11337158 CTGGCTGTGGGTTGGGGGTGGGG - Intronic
1162935629 19:13980194-13980216 CTGGGTGTGGATTTGGGGGCTGG + Intronic
1163639182 19:18451756-18451778 CCTGCTCTGGATTTGGGAGGAGG - Intronic
1166103984 19:40588725-40588747 CTGGCTCTGGAGTCGGCAGATGG + Exonic
1166411078 19:42555718-42555740 CTGGCCCTGAATACTGGGGGGGG + Intronic
1166877409 19:45905826-45905848 CTGGCTCTGGGTTCACGAGGCGG + Intergenic
1166947301 19:46404980-46405002 CTGGCTCCGGGATCGGGGTGGGG - Intergenic
1166983363 19:46645087-46645109 CTGACTGTGGATTCAGGTGGGGG + Intergenic
925309868 2:2874948-2874970 CTGGCTCTGGCTCTGGGCGGAGG - Intergenic
926088269 2:10033476-10033498 CTGGCCCAGGGTTCGGGGAGAGG - Intergenic
927257072 2:21048918-21048940 CTGGCTCTGGAATGGTGGGCAGG + Intergenic
927993164 2:27462426-27462448 CAGGCTCTGGACTGGAGGGGAGG + Intronic
929458870 2:42086526-42086548 TTGGGTCTGGATTTGGGGAGGGG - Intergenic
930173947 2:48282030-48282052 GTGGCACTGGATTCTGGGAGAGG - Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
931687336 2:64805780-64805802 CTGGGCCTGGAGTCGGGTGGGGG + Intergenic
932780100 2:74554281-74554303 CTGGCCCGGGACTCGGAGGGAGG - Exonic
937867650 2:126766058-126766080 CAGGCTGTGGAATTGGGGGGTGG + Intergenic
938083909 2:128385711-128385733 CTTGCTCTGGGGTCGTGGGGTGG - Intergenic
940286950 2:152042050-152042072 CTGGCTCTGCATTTAGGGTGAGG - Intronic
940829936 2:158456613-158456635 CTGGCTCTGAAATCTGGGGCAGG - Exonic
942219601 2:173756297-173756319 TGGGCTCTGGATTATGGGGGTGG + Intergenic
944802907 2:203253822-203253844 CTTGCTCTGGATGGGGGTGGTGG + Intronic
948518816 2:238522945-238522967 CTGGCTCTGAATTCAGGGCTGGG - Intergenic
948568948 2:238905282-238905304 CTGGCCCAGGAGTCGGGGGATGG - Intronic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1172127212 20:32631872-32631894 CTGGCTCTGGCCTTGGGGAGAGG - Intergenic
1172770306 20:37378748-37378770 CCGCCTCTGGCTGCGGGGGGAGG + Intronic
1174115336 20:48223049-48223071 ATGGCTCTGGACTTGGGTGGTGG + Intergenic
1175589500 20:60177461-60177483 CTGGGACTGGATTTGGGGGCAGG + Intergenic
1175992104 20:62794653-62794675 CAGGCGCTGGACTCTGGGGGCGG + Intergenic
1175998523 20:62821858-62821880 CTGGCTGTTGAGTCTGGGGGTGG - Intronic
1178476970 21:32945358-32945380 CAGGCTCTGGCTCTGGGGGGAGG + Intergenic
1180225786 21:46391321-46391343 CCGTCTGTGGAGTCGGGGGGAGG + Exonic
1182760346 22:32717553-32717575 GTGGCTCTTTATTCTGGGGGTGG + Intronic
1182771809 22:32801791-32801813 CTGGCGCAGGACTCGGCGGGCGG - Exonic
1182796359 22:32994276-32994298 CTGGCCCTGGTGTCTGGGGGAGG - Intronic
1182857948 22:33534698-33534720 CTGGTTCTGGGTTTGGGGAGAGG + Intronic
1183976054 22:41513012-41513034 CTGGCTCTGGTTTCAGAGCGGGG - Intronic
1184674405 22:46032631-46032653 CAGGCTCTGGACTCTGGGGAAGG - Intergenic
950198740 3:11028159-11028181 CTGGCTCCGGATGGGGGTGGGGG - Intronic
950481601 3:13247727-13247749 CTGGATCTGGATCTGGAGGGAGG + Intergenic
951016768 3:17740949-17740971 CTGAGTCTGGATTCCAGGGGAGG - Intronic
952712837 3:36448903-36448925 CTGGGTCGGGAGTGGGGGGGGGG - Intronic
953582038 3:44166328-44166350 CTGCCTCTGGAGTCTGGGTGGGG - Intergenic
954331213 3:49891364-49891386 CTGGCTCTGGGTTGGGGGCTGGG - Intronic
955687834 3:61563114-61563136 CTGGGTCTGGACGCGGGGAGGGG + Intronic
958701198 3:97592682-97592704 CTGGCACTGGATGCGGGGCCTGG - Exonic
961211871 3:125131820-125131842 TTGGTTCTGGAGTCGGGGGCAGG + Intronic
961677858 3:128578470-128578492 CTGGCTCTGGAACCCTGGGGAGG - Intergenic
962230481 3:133661645-133661667 CTGGCCCTGGAGCCGGCGGGTGG - Intronic
963394580 3:144715473-144715495 CTGGCTATGGCTTCAGAGGGTGG - Intergenic
963593008 3:147286615-147286637 GTGGCTGTGGCTTCAGGGGGTGG - Intergenic
964836154 3:160940558-160940580 CGGGCTGTGGCTTCGGAGGGTGG + Intronic
965842140 3:172918481-172918503 CTGCATTTGGCTTCGGGGGGAGG - Intronic
966313146 3:178616490-178616512 GTGTCTCTGGATGCTGGGGGAGG - Intronic
968324920 3:197805403-197805425 CTGGGTCTGGATTTGGGTGTAGG + Intronic
968636973 4:1685507-1685529 CTGGGGCTGGATGCTGGGGGAGG + Intergenic
968706408 4:2080396-2080418 TTGGCTCTGGGCTCGGGGGTGGG + Intronic
969072772 4:4552695-4552717 CTGGCTGGGGATTTGTGGGGAGG + Intergenic
969126366 4:4951271-4951293 ATGGCTCCAGATTCGGGGGATGG - Intergenic
970195133 4:13544633-13544655 CTGGCTCTGGATTCGGGGGGAGG - Exonic
975473246 4:74794199-74794221 CTGGGGCTGGAGTCGCGGGGAGG - Intronic
981515416 4:145603429-145603451 CTGGCTCTGGATTGAGTGCGGGG + Intergenic
981588462 4:146329553-146329575 CAGGCTCTGGAGTCAAGGGGAGG - Intronic
982130684 4:152226208-152226230 CTGCCTCTGGATTAGGGTGTTGG - Intergenic
982163842 4:152596761-152596783 CTGGCTGTGGATTGGAGGGTGGG + Intergenic
986464568 5:8008402-8008424 CTGGCTCTGGAATCTGGGGTAGG + Intergenic
988609816 5:32713372-32713394 GTGGCTATGGCTTCGGGGAGCGG + Intronic
989999693 5:50878667-50878689 CTGGCTCTGGCTTTGGGGATAGG - Intergenic
994849495 5:105036083-105036105 CTGTCTCTTGCTTCAGGGGGTGG - Intergenic
996441130 5:123492047-123492069 ATGTCTCTGGATTGGGGAGGAGG - Intergenic
997825810 5:137106121-137106143 CTGGCTCTGGTTGTGGTGGGGGG - Intronic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
1000676342 5:164126984-164127006 CTGGCTGTGGCTTCAGAGGGTGG - Intergenic
1002324133 5:178394395-178394417 CTGCCTCTGCATTCCTGGGGTGG - Intronic
1003636513 6:7836364-7836386 CTGGATCTGGATTTGGGTGGTGG + Intronic
1005339753 6:24832019-24832041 CTGGGTCTGACTTCTGGGGGTGG + Intronic
1005877400 6:30022264-30022286 GAGGTTATGGATTCGGGGGGAGG - Intergenic
1007117235 6:39351390-39351412 CCGGCTATGGATTTGTGGGGAGG + Intronic
1015815669 6:137208565-137208587 CAGGCTGTGGCTTCGGAGGGTGG + Intronic
1018420611 6:163637637-163637659 CTGCCTCTGGAGTCTGGTGGTGG + Intergenic
1018612687 6:165660863-165660885 CTGGCGCCGGAGTCGGGCGGGGG + Intronic
1019832440 7:3346266-3346288 CTGGGGCTGGTTTCGGTGGGTGG + Intronic
1024253640 7:47524032-47524054 CTGGCTGTGAATCCTGGGGGTGG - Intronic
1024498195 7:50071185-50071207 GTGTCTCTGGATACTGGGGGAGG + Intronic
1026268750 7:68818398-68818420 CTGGCTTTGGATTCCTGGGAGGG - Intergenic
1030935592 7:115581926-115581948 ATGGCTCTGTATGTGGGGGGGGG - Intergenic
1031034236 7:116770107-116770129 CTGGCTCTGGCCTCCTGGGGTGG - Intronic
1032263699 7:130355997-130356019 GTGGCACTGGATGTGGGGGGTGG - Intronic
1032389983 7:131549677-131549699 CTGGCCCTGGATTGGGGTGCAGG - Intronic
1034655205 7:152723672-152723694 CTGGTTCTGGATTTTGTGGGGGG - Intergenic
1034699560 7:153084276-153084298 CTGGCTGTGGAGTGGTGGGGGGG - Intergenic
1035202041 7:157273805-157273827 CTGACTCTGGTTGCGGGGGCAGG - Intergenic
1035274564 7:157739931-157739953 CTGGCTCTGGCTTCTGGAAGAGG - Intronic
1037061971 8:14524338-14524360 CTGCTCCTGGATTCGGGTGGGGG + Intronic
1037990012 8:23315057-23315079 TTGGCTCTGGCTTTGGGGAGGGG + Intronic
1039200581 8:35088736-35088758 CTTGCTCTGTATTTGGGGTGGGG + Intergenic
1042226874 8:66521123-66521145 CTGACACTGTATTGGGGGGGTGG + Intergenic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1048927099 8:139281053-139281075 GTGGGTCTGGATTCAGGGTGGGG + Intergenic
1049475868 8:142796787-142796809 CAGGCACTGGAATTGGGGGGTGG - Intergenic
1049679819 8:143913141-143913163 CTGGCCCTGGAGTCAGGGGTCGG + Intergenic
1050266661 9:3897855-3897877 CTGGCTCTGGAATCAGATGGGGG + Intronic
1053412351 9:37923882-37923904 CTGGCTCGGGATGCGGGGCCGGG - Intronic
1058905931 9:109482757-109482779 CTGGAGCTGGTTTCTGGGGGAGG - Intronic
1059432262 9:114257347-114257369 CTGGGCCTGGAATCGGGGTGGGG + Intronic
1061296876 9:129681690-129681712 CTGGTTCTGGTTTTGGGGGGTGG - Intronic
1062064980 9:134521885-134521907 CGGGCTCTGGTTTCAGGGGCCGG - Intergenic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1190230898 X:48581059-48581081 CTGGATCTGGGGGCGGGGGGGGG + Intergenic
1191065626 X:56343879-56343901 CTTCCTCTGGTTTCGGGGTGGGG + Intergenic
1192034039 X:67544675-67544697 CTGGCTCCGCACTCGGGGTGGGG - Exonic
1192934910 X:75849371-75849393 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1195473408 X:105259162-105259184 CTGTCTCTGGTTTCAGAGGGGGG + Intronic
1196833024 X:119791256-119791278 CTCGTTCTGGAGGCGGGGGGTGG - Intronic
1198497710 X:137209762-137209784 CTGGCTCAGGATGCAGGGGTTGG - Intergenic