ID: 970197736

View in Genome Browser
Species Human (GRCh38)
Location 4:13569206-13569228
Sequence ACAGAGAAGAGGAATGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 1, 2: 12, 3: 132, 4: 1179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970197736 Original CRISPR ACAGAGAAGAGGAATGAAGA GGG Exonic
900363190 1:2299786-2299808 ACAGAGAAGAGCCATTGAGAAGG - Intronic
900382845 1:2393469-2393491 GCAGAGAAGAGGACTGCAGAGGG + Intronic
900770059 1:4533794-4533816 AGAGAGAAGGTGAATGAATAGGG - Intergenic
900857630 1:5198753-5198775 GCAGAAAAGAGGGATGAAAAGGG + Intergenic
900902712 1:5527718-5527740 TCAGAGAAGGGGCATGATGAGGG - Intergenic
901201554 1:7470116-7470138 ACAGAGGAGAGGGATGGGGAGGG - Intronic
901411550 1:9087829-9087851 AGAGAGAAGAGGAAGGAAGAGGG - Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
902217106 1:14941213-14941235 ACAGAAAAGGTGAATGAAGACGG - Intronic
902675726 1:18007356-18007378 AGAGAGAGAAGGAAAGAAGAAGG + Intergenic
902676997 1:18015702-18015724 ACAGAGAAGAGGAAAATAAAAGG + Intergenic
902713756 1:18258292-18258314 ACAGAGAAGAGAACAGAAGTAGG - Intronic
902994564 1:20213532-20213554 ACAGAGATGAGGAAAGGTGATGG - Intergenic
903038861 1:20513366-20513388 AAAGAGAAGAGGGAGGAAGGAGG + Intergenic
903305987 1:22413721-22413743 CCAGGGAAGAGGAAGGAGGAAGG - Intergenic
904447812 1:30588816-30588838 ACAGAGCAGGGGAAAGAGGAGGG + Intergenic
904564562 1:31420700-31420722 ACAGAGAAGTGGCATGACCAAGG - Intronic
904754401 1:32760250-32760272 TCAGGGGAGAGGAATGAAGGGGG - Intronic
905076834 1:35279402-35279424 ACAGAAACGAGGAATGGAGATGG - Intronic
905132596 1:35772020-35772042 AAAGAGAAGAGGATGGATGATGG - Intergenic
905703696 1:40038916-40038938 AGAGAGAAGAGGAAGCAGGAAGG - Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
906829295 1:49014728-49014750 ACAGACCAGAGCAATGAAGGAGG - Intronic
906922814 1:50082823-50082845 ACAGAGAAAAGGAGGGAAGGAGG - Intronic
907049992 1:51323514-51323536 ACAGAGAAGAGAGAAGAAGGTGG - Intronic
907598114 1:55739071-55739093 ATAGAGAAGAGCACTGAATAAGG + Intergenic
907668823 1:56456797-56456819 ACATAGCAGAGCAAGGAAGATGG - Intergenic
907758907 1:57338313-57338335 GCAGAGAAGGGGAATGGAGAAGG - Intronic
907775649 1:57511755-57511777 AGAAAGTAGAGGGATGAAGATGG - Intronic
907861141 1:58354653-58354675 ACACAGAGGAGGAAGGGAGAGGG + Intronic
908423894 1:63986396-63986418 AAAGGGAAGAGGAATGAAAATGG + Intronic
908474278 1:64472289-64472311 GGAAAGAAGAGGAAGGAAGAAGG - Intronic
908600359 1:65732189-65732211 ACAGAGAGGAGATATTAAGATGG - Intergenic
908766485 1:67559149-67559171 ACAGAGGAGAGGAATGAGTAAGG + Intergenic
908961816 1:69707340-69707362 ACTCAGCAGAGGGATGAAGAGGG - Intronic
909328792 1:74387605-74387627 ACAGAGATTAGGAATCAAGATGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909622087 1:77680360-77680382 GGAGAAAAGAGGAATGTAGAAGG - Intronic
909890882 1:81005224-81005246 ACGGAGAAGAGGAAGAAAGCAGG - Intergenic
909931606 1:81504323-81504345 AAATAGAAGAGGGCTGAAGAAGG - Intronic
910097159 1:83536758-83536780 ACATTGAAGAGGAATAAAGTTGG + Intergenic
910217057 1:84853514-84853536 AGAGAGAAGAAGCAGGAAGAGGG - Intronic
911205733 1:95090180-95090202 AGAGAGAAGAGAAAAGGAGAAGG - Intergenic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911495973 1:98631871-98631893 ACAGAGAAGAAGAGGAAAGAAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911661771 1:100509312-100509334 ACACAAAAGAGGGATGAGGAAGG - Intronic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
911741653 1:101392627-101392649 AAAAAGAAGAGGAAAGAAGAGGG - Intergenic
911779430 1:101857597-101857619 AGAGAGAAGGGGAAAGGAGAGGG - Intronic
912489307 1:110052991-110053013 ACAGAGGAGGAGAATGAAAAAGG - Intronic
912696948 1:111848987-111849009 TCAGAGAGGAGGAAAGGAGAGGG - Intronic
912723793 1:112041734-112041756 ACAGAGATGAGAAAGGAAGAAGG - Intergenic
912724268 1:112044718-112044740 ACAGAGAAGACGGAGGAACAAGG + Intergenic
912841402 1:113042618-113042640 AAAGAGAGCAGGAATGAAGGCGG + Intergenic
912911958 1:113770339-113770361 ACAGAGAAAAGGAAAGAATCTGG + Intronic
913082723 1:115403693-115403715 GCACAACAGAGGAATGAAGATGG - Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
913940315 1:125097714-125097736 AAAGAGAAGAGAAAGGAAGATGG - Intergenic
913944296 1:125143154-125143176 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
913954893 1:143280624-143280646 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
913982543 1:143534742-143534764 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
914252938 1:145936752-145936774 AAAGATTATAGGAATGAAGAGGG + Intronic
914429743 1:147610598-147610620 ACAAAGTATAGGAATGAAGGAGG - Intronic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915123753 1:153649169-153649191 ACAGAGAAGAGAAAGGAGGTGGG + Intergenic
915142002 1:153773617-153773639 ACAGAGAAGGGAAATGACAAAGG + Exonic
915303381 1:154964012-154964034 ACAGACAAGAGGCTTGAAGGAGG + Intronic
915310114 1:155002369-155002391 ACAGAGAGAAGGAAAGAAGGAGG + Intergenic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
916210555 1:162356543-162356565 GCAGAGTAGAGGATTGAAGCTGG + Intronic
916424656 1:164669098-164669120 ACAAAGAGGAGGGAAGAAGAGGG - Intronic
916946951 1:169738595-169738617 AATGAAAAGAGGAAAGAAGACGG + Intronic
917090005 1:171343337-171343359 ACAGAGCAGAGCAAAGATGATGG + Intergenic
917148735 1:171921964-171921986 AATGAAAAGAGCAATGAAGAAGG - Intronic
917229090 1:172816710-172816732 AGAGAGAAGAGCAAGGAAGTGGG + Intergenic
917464570 1:175264442-175264464 ACAGGGGAGAGGAATTATGAGGG + Intergenic
917475231 1:175363596-175363618 ACAGAGAAGAGGAAAAACGCAGG + Intronic
917544365 1:175947911-175947933 TGAGAGAAAATGAATGAAGAAGG - Intronic
917630979 1:176891113-176891135 ATAGAAGAGAGGAATTAAGAAGG + Intronic
917868356 1:179219391-179219413 ACAGAGAAGAAGAAAAAAAAAGG + Intronic
918230968 1:182531390-182531412 ACAGAAAAAAGGAAGAAAGAGGG + Intronic
918236669 1:182586918-182586940 ACAGAGCAGCAGTATGAAGAAGG + Exonic
918241072 1:182620854-182620876 AGAGATAAGAGGAAAGTAGAAGG + Intergenic
918275316 1:182948471-182948493 ACATTGAAGATGAAGGAAGAGGG + Intronic
918363124 1:183779236-183779258 AGAAAGAAGAGGAAGGAAGGTGG - Intronic
918371505 1:183866387-183866409 AAAGTGAAGAAGAATGAAGCAGG + Intronic
918372753 1:183877654-183877676 ACACAAAAGAGGAATGAAGGGGG - Intronic
918429762 1:184447478-184447500 AAAGAGTAGACGAATGAATAGGG - Intronic
918482181 1:184990787-184990809 AGAGAGAAGAGAATTGCAGAAGG + Intergenic
918553388 1:185770243-185770265 ACTGAAGAGAGGAATGAACAAGG + Intronic
919122492 1:193358556-193358578 AGAGACAAGAGAAATAAAGAGGG + Intergenic
919183927 1:194120009-194120031 AGAGAGAAATGAAATGAAGATGG + Intergenic
919503001 1:198361685-198361707 GGAGAGAAGAGGGAGGAAGAGGG - Intergenic
919670115 1:200330666-200330688 TCAGGGAAGAGGGAGGAAGATGG - Intergenic
919997098 1:202762255-202762277 ACAAAAAAGAGAAAGGAAGAAGG - Intronic
920600161 1:207316995-207317017 ACAGAGAAAGGGAAAGGAGAAGG - Intergenic
920608955 1:207418757-207418779 ACAGGGAAGGGGAATGAAAGTGG + Intergenic
920610318 1:207429731-207429753 AAAGAAAAGATGAATGCAGATGG + Intergenic
920714688 1:208328515-208328537 AGAGAGAAGAGAAATAAAGAGGG - Intergenic
920734848 1:208523975-208523997 AGAGAGAAGAGAAAAGAAGAAGG - Intergenic
920743560 1:208604177-208604199 ACAAAGAAGAGGAAAGAAAGAGG - Intergenic
920812802 1:209302999-209303021 ACAGAGGAGAGGAAGGAGGGAGG + Intergenic
920884449 1:209913010-209913032 AGTGAGAAGAGGAAGGAAGGAGG - Intergenic
920888910 1:209963233-209963255 TGAGAGAAGAGGAATAGAGATGG + Intronic
921170469 1:212543035-212543057 ACCAAGAAGAGAAATGAAGCAGG - Intergenic
921222075 1:212980457-212980479 ACAGAGATCAGTGATGAAGAAGG - Intronic
921773197 1:219067756-219067778 ACACAGCAGAGGAATCAAGATGG - Intergenic
921874706 1:220181426-220181448 ACAAAGAAGAACAAGGAAGATGG + Intronic
921923432 1:220692062-220692084 ACAGTGAAGTGGTATGAAGTAGG + Intronic
922574906 1:226655034-226655056 ACAGGGAAGAGGAGAGAAGAAGG + Intronic
923049161 1:230378617-230378639 ACAGAGAACAGGCAAGAAGTAGG - Intronic
923202212 1:231723803-231723825 ACAAAAAAGAGGGAGGAAGAAGG - Intronic
923363511 1:233236091-233236113 GGAGAGAAGAGGATTGTAGATGG - Intronic
923397632 1:233582759-233582781 AAAGTGAAGAGAAGTGAAGATGG + Intergenic
923765863 1:236891857-236891879 ACAGAGAAGATGAAGGATGATGG + Intronic
923772657 1:236951067-236951089 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
923772680 1:236951224-236951246 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
924502387 1:244649888-244649910 AGAGAGAAGAGCACCGAAGATGG + Intergenic
924566580 1:245203751-245203773 ACAGAGACAAGGAGTGGAGAGGG - Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
924734179 1:246739776-246739798 ACAGAGAGCAGGAAAGTAGATGG - Intronic
1062773983 10:130032-130054 ACAGAGAAGGGAACTGAAGCTGG + Intergenic
1062812631 10:477991-478013 AGATAGAAGAGGAAAAAAGAGGG + Intronic
1063153352 10:3356335-3356357 AGAAAGAAGAGGAAGGGAGAAGG - Intergenic
1063283903 10:4662039-4662061 ACAGACAAGAGGCATGGAGAGGG - Intergenic
1064154461 10:12892150-12892172 ACAGAATAAAGGGATGAAGATGG - Intergenic
1064178791 10:13098013-13098035 ACAGATAAAGGGAATGAGGAAGG + Intronic
1064307041 10:14176778-14176800 ACAGAGAATAGAATTAAAGATGG - Intronic
1064414532 10:15136899-15136921 ACAGCGCAGAGGACTGAATATGG + Intronic
1064482878 10:15757061-15757083 AGAGAGAAGGGGAATGAAGATGG + Intergenic
1064544219 10:16435294-16435316 AAAGAGAATAGGTATGCAGATGG - Intergenic
1064720077 10:18220075-18220097 AAGGAGAAGAGGAATTAAGATGG - Intronic
1064841428 10:19596776-19596798 AAAGAGAGAAGGAAGGAAGAGGG + Intronic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065050369 10:21785787-21785809 GCAGAGAAGATGAAAAAAGATGG + Intronic
1065146569 10:22774600-22774622 ACAGAGAATAGGAATATAAATGG - Intergenic
1065181432 10:23129993-23130015 ACAAAGAAGAGTAATCAAGGTGG - Intergenic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065709020 10:28497658-28497680 AGATAGAAAAGGAAGGAAGAAGG + Intergenic
1065866561 10:29919860-29919882 AAAGAGAAGAGGAAAGAGAAGGG - Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066064275 10:31750738-31750760 CCAGAGAAGAGAAAAGCAGATGG - Intergenic
1066156684 10:32685460-32685482 GCAGAAAAGAGGAATGAGAAAGG + Intronic
1066779838 10:38932095-38932117 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1066950180 10:42110376-42110398 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1066951378 10:42121549-42121571 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1067817396 10:49491850-49491872 ACAGATAACAGAAATGAAAAAGG + Intronic
1068068062 10:52157797-52157819 AAAGGAAAGAGGAAGGAAGAAGG - Intronic
1068594460 10:58887975-58887997 ACAGAGAACAGGGAATAAGAAGG - Intergenic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069120804 10:64567166-64567188 AAAGTGAAGAGGAATCTAGAGGG + Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069698026 10:70401718-70401740 ACAGAGGATAGGACTAAAGATGG - Intergenic
1070092973 10:73307211-73307233 ACACAGAAAAGGAAAGAAGAGGG + Intronic
1070308211 10:75252718-75252740 ACAGAGAACACAAGTGAAGATGG - Intergenic
1070383077 10:75899135-75899157 GCAGAGAAGACTATTGAAGAAGG + Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070423182 10:76258252-76258274 ACTGAGACGAAGTATGAAGATGG - Intronic
1070671467 10:78380439-78380461 ACAGAGAGGATGAAAGAACATGG + Intergenic
1070782351 10:79145051-79145073 ACAGAGAAGAAGAAAACAGAAGG - Intronic
1070878353 10:79838005-79838027 AGAGACAAGAGGACTGGAGAAGG - Intergenic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1071644904 10:87354316-87354338 AGAGACAAGAGGACTGGAGAAGG - Intergenic
1071661062 10:87503706-87503728 AAAGAGAAAAGGAGTAAAGATGG + Intergenic
1071991526 10:91104775-91104797 ACAGAGGAGAGGAAGAGAGAGGG - Intergenic
1071991595 10:91105199-91105221 ACAGAGGAGAGGAAGAGAGAGGG + Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072058567 10:91786456-91786478 ACAGAAAAAAAGAATGAATAAGG - Intergenic
1072153245 10:92700199-92700221 AAAGAGAAAGGGAATGAATAAGG - Intergenic
1072178958 10:92960667-92960689 ACAAAGGAGAGGAATGAGGAAGG - Intronic
1072313840 10:94182570-94182592 AGAAAGAAAAGAAATGAAGATGG - Intronic
1072546408 10:96442749-96442771 ACAGAGGACAGGAAGGAAGACGG - Intronic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073587735 10:104726789-104726811 AAAGGGCAGAGGAATGGAGATGG - Intronic
1073954946 10:108859546-108859568 AAAGAGAAGAGAAGAGAAGATGG + Intergenic
1074403333 10:113160334-113160356 AGAGAGAAGAGGAGGGGAGAAGG - Intronic
1074440448 10:113473013-113473035 ACAGAGAAGAGAAGTATAGAAGG - Intergenic
1074656154 10:115589901-115589923 ATAAAGAAGAGCAATGAAGATGG - Intronic
1074724073 10:116289652-116289674 ACAGAGAGAAGGAAGGAGGAAGG - Intergenic
1075347466 10:121694203-121694225 ACAGAGGAGAAGAAGGAAAAAGG - Intergenic
1075497618 10:122939322-122939344 AAAGAGAAAAGAAGTGAAGAAGG + Intronic
1075721387 10:124589657-124589679 CCAGAGAACAGGAGTGAAGGAGG - Intronic
1075838605 10:125477672-125477694 AGGGAGAGGAGGAAAGAAGAAGG + Intergenic
1075889159 10:125930636-125930658 ACACTGAAGAACAATGAAGATGG - Intronic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076566861 10:131404767-131404789 ACAGAGCAGACAAATGGAGATGG + Intergenic
1076811183 10:132887285-132887307 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1076811197 10:132887356-132887378 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1076811208 10:132887424-132887446 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1076811242 10:132887595-132887617 AGAGAGGAGAGGAGAGAAGAAGG - Intronic
1076915412 10:133420986-133421008 AGAGGGAAGAGGAAGGAAGGTGG + Exonic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077523784 11:3051772-3051794 ACAGGGGAGAGGAATGTGGAGGG - Intronic
1077893503 11:6436890-6436912 TCAGAGATGAGGGATGCAGAAGG + Intronic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078387514 11:10905412-10905434 ACAGAGCAGGGGCATGAGGAGGG - Intergenic
1079120770 11:17683226-17683248 ACAGGGAAAAGGAATGAAATAGG + Intergenic
1079282483 11:19099876-19099898 GCAGAAAAGAGGACTGAGGAGGG - Intergenic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079439602 11:20497592-20497614 GCAGAGCAGAGTACTGAAGAGGG + Intronic
1079597492 11:22269054-22269076 AGAGAGAAAAGGAAAGAAGGAGG + Intronic
1079661044 11:23036920-23036942 ACAGTCAAGGGGAATGGAGAGGG + Intergenic
1079961676 11:26931949-26931971 AGGGAGCAAAGGAATGAAGAAGG + Intergenic
1080279237 11:30537605-30537627 ACAGATAAGAGGAAATAAAAAGG - Intronic
1080338006 11:31221658-31221680 GCAGAGACCAGGAATGGAGATGG - Intronic
1080461965 11:32462583-32462605 ACAGAGAAAAGGAAGGAGGGAGG + Intergenic
1080596950 11:33781546-33781568 AAAGAGAAGATGAAAGAAGGCGG + Intergenic
1080851925 11:36077801-36077823 GCAGACAAGAGGAGAGAAGAAGG - Intronic
1080930412 11:36804362-36804384 AGAGAGAGAAGAAATGAAGAAGG - Intergenic
1081283802 11:41244543-41244565 ACAGAGATAAAGAATGAAGGTGG + Intronic
1081947645 11:47012438-47012460 AGAGAGAAGAGGAAGAAAAAAGG + Intronic
1082611996 11:55311182-55311204 ACAGAGAAGACTAAGGAAGGAGG - Intergenic
1082898761 11:58222213-58222235 AGAGAGAAGAGGATGGAAGTTGG + Intergenic
1082987892 11:59183685-59183707 ACTGGGAGGAGGAATGAAGGAGG + Intronic
1083330034 11:61893166-61893188 ACACAGCACAGGAATGGAGAAGG + Intergenic
1083431603 11:62616271-62616293 ACAGAGAGGATGAAGGAATAAGG - Intronic
1083458389 11:62794491-62794513 TCAGAGAATAGGAATGATGTTGG - Intronic
1083473761 11:62902154-62902176 GAAGAGAGGAGGAAAGAAGAGGG + Intergenic
1084005513 11:66321385-66321407 AGAAAGAAGGGGAAGGAAGAAGG + Intergenic
1084023296 11:66431387-66431409 AGAAAGAAAAGGAAAGAAGAAGG + Intergenic
1084339860 11:68490058-68490080 ACAGATTAGAGGACTGGAGAGGG - Intronic
1084948821 11:72653606-72653628 AGAGAGGAGAGGACTGGAGAGGG + Intronic
1085026898 11:73241672-73241694 ACCCAGAAGAGGAGTGATGAAGG - Intergenic
1085228202 11:74941828-74941850 ACAGAAAAAAGGAATGAGAAAGG + Intronic
1085446072 11:76601875-76601897 GCAGAGCAGAGGCCTGAAGAAGG - Intergenic
1085474354 11:76780609-76780631 ACAGACATGAAGAATGGAGAAGG + Intergenic
1085539897 11:77257506-77257528 AAAGAAGAGAGGAAGGAAGAGGG - Intronic
1085694932 11:78696124-78696146 ACACAGCTGAGGAAAGAAGATGG - Intronic
1085712980 11:78846858-78846880 AGAGAGAAGGGAAATGAATATGG - Intronic
1085778795 11:79390105-79390127 ACAGAGCAGTGGAATGAAGGTGG + Intronic
1085783611 11:79432236-79432258 ACAGAGATGAGGGAGGAAGAAGG - Intronic
1085836952 11:79967007-79967029 GGAGAGAAGAGAAAGGAAGATGG + Intergenic
1085837194 11:79969731-79969753 GGAGAGAAGAGAAAAGAAGATGG + Intergenic
1085936431 11:81151451-81151473 AGAGAGAAGAGGAAGGAAAGAGG + Intergenic
1086097971 11:83069565-83069587 ACAGGGAACAGGAAGAAAGAGGG + Intronic
1086771996 11:90777887-90777909 ACAGAGAAGAAAAATAAAGCAGG + Intergenic
1086831641 11:91573072-91573094 ACAGGAGAGAGGAATGAAAAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088315762 11:108504848-108504870 TAATAGGAGAGGAATGAAGAAGG - Intergenic
1088354628 11:108929657-108929679 ACAGAAAAGTGGAATTGAGATGG + Intronic
1088551460 11:111017537-111017559 ACAGAGGGCAGGAGTGAAGAAGG + Intergenic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088727904 11:112655833-112655855 CCAGTAAAGAAGAATGAAGAAGG - Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088821939 11:113464042-113464064 ACAGGGAATAGGAAAGAAAATGG - Intronic
1089019968 11:115203346-115203368 ACAGAAAAGAGGAAGGCAGAGGG + Intronic
1089592843 11:119555737-119555759 ACAGGGAGGAGGAAGGCAGATGG - Intergenic
1089749024 11:120637113-120637135 AAAGAGAAGAGGAGGGAAGGAGG + Intronic
1089797699 11:120995627-120995649 ACAGCTGAGAGGTATGAAGATGG + Intergenic
1089876424 11:121726135-121726157 ACAGAGAACTGGAATGAGGGTGG - Intergenic
1090124526 11:124071952-124071974 GCTCAGAAGAGGAATGATGAAGG - Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090661629 11:128886392-128886414 AAGGAGAAGAGGAATGAAACTGG - Intergenic
1090731763 11:129578633-129578655 ATAGAGTAGAGGAAGGGAGAAGG - Intergenic
1091169102 11:133504991-133505013 ACAGGGAAGATGAATGTAGCAGG + Intronic
1091427758 12:406241-406263 ACAGAGAAGAGGGATGAGGTTGG + Intronic
1092072388 12:5642162-5642184 ACAGAAAAGAGAATTGAAAAGGG - Intronic
1092995820 12:13949393-13949415 GGAGAGAAGAGGCAGGAAGAGGG - Intronic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094582005 12:31741969-31741991 AAAAAGAAGAGGAAGGGAGAAGG + Intergenic
1095381538 12:41600130-41600152 AGAATGAAGAGTAATGAAGAGGG - Intergenic
1095518764 12:43037230-43037252 ACAGACATGAGGGAAGAAGAAGG + Intergenic
1095540644 12:43305225-43305247 AGAAAGAAGAGGAAGAAAGAAGG + Intergenic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095788205 12:46134459-46134481 AGAGAAAGAAGGAATGAAGAAGG - Intergenic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1095908549 12:47402717-47402739 ACAGAGCAGAGAAATAAAGGAGG + Intergenic
1095922244 12:47543069-47543091 AGAGAGAAAAGGAGAGAAGAAGG + Intergenic
1096229875 12:49890869-49890891 AGGGAGAAGGGGAATGGAGAAGG - Intronic
1096407967 12:51357573-51357595 ACAGAGGAGAGAAATGACGGGGG - Intronic
1096902196 12:54896321-54896343 ACAGACAGGAGGGAAGAAGAAGG - Intergenic
1096943127 12:55371696-55371718 ACAGAGAAAAGACGTGAAGAAGG - Intergenic
1097309845 12:58106471-58106493 ACAGACAACAAGCATGAAGATGG - Intergenic
1097316620 12:58178122-58178144 ACAGAGCAGAGGACTGTAGAAGG + Intergenic
1097350598 12:58544448-58544470 ACAGAGAGGAGAAAGGAAGAAGG - Intronic
1097496239 12:60339597-60339619 AAAGAGAAGAGCAAGAAAGAGGG + Intergenic
1097515960 12:60606764-60606786 AAAGGGAAGAGGAAGGGAGAGGG - Intergenic
1098080758 12:66782849-66782871 ACAGAGAAGGAAACTGAAGATGG + Intronic
1098082216 12:66799568-66799590 ACAGGGAAGAGGAAGGAACTGGG - Intronic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098525618 12:71483356-71483378 TCAGAGAAGGGGACTGAATAAGG + Intronic
1098954128 12:76670955-76670977 TCTAAGAAGAGGAATGCAGATGG + Intergenic
1099027516 12:77484164-77484186 ACAGAGAAAAAGAAGGCAGAGGG + Intergenic
1099131029 12:78831373-78831395 ACAAAAAAGAGGTATCAAGAAGG + Intergenic
1099681713 12:85837247-85837269 GCAGGGCAGAGGAATGGAGATGG + Intergenic
1100177933 12:92051864-92051886 AGAGAAAAGAGGAATCAAGAAGG - Intronic
1100236815 12:92669817-92669839 ACAGAGAAATGGGAAGAAGAAGG - Intergenic
1100492591 12:95095564-95095586 GCAGAAAAGAGGAAGGGAGAGGG + Intronic
1100530701 12:95458980-95459002 ACAGAGAGGTGGAATGATGCTGG - Intergenic
1100650529 12:96583884-96583906 ACAGTGAAAGGGAAGGAAGAGGG - Intronic
1100698584 12:97121997-97122019 ACAGAGAAGTATAAAGAAGAAGG + Intergenic
1100749762 12:97685663-97685685 AGAGAGAGAAGGAAGGAAGAAGG + Intergenic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1101170203 12:102084344-102084366 ACAGAGAAAAAGCATGGAGATGG + Intronic
1101259579 12:103014437-103014459 ACAAAGAAGAGGGAGGAAGAGGG - Intergenic
1101275106 12:103190808-103190830 AAAGAGAAGAGAAAAGAAAATGG + Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101369355 12:104111521-104111543 TCACAGAAGAGGAATCATGATGG - Intergenic
1101388769 12:104281128-104281150 CCAGAGAGGAGGAAGAAAGATGG - Intronic
1101408945 12:104453446-104453468 AGAGAGAAAGGGATTGAAGAAGG - Intergenic
1101510946 12:105391777-105391799 AGAGAGAAGAGGAAATGAGAGGG + Intronic
1101696873 12:107135058-107135080 ACAGAGAACAGGTATGGAGTGGG + Intergenic
1101750378 12:107578560-107578582 ACTGAGCAAAGGAATGATGAGGG + Intronic
1101777314 12:107806416-107806438 ACAGAGAAGAGTCATGTAGGTGG + Intergenic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102094729 12:110228398-110228420 ACAGAGAAGAGCAATACAGGTGG + Intergenic
1102734440 12:115145841-115145863 ACAGAAAAGAGGTTTGGAGAAGG - Intergenic
1102803985 12:115763224-115763246 AAAGAGAAGAGGAACAAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103123446 12:118400062-118400084 ACAGAGAGGAGTGAAGAAGAAGG + Intronic
1103348546 12:120266676-120266698 ACAGAGAAGGGGAAATAAGCAGG + Intergenic
1103799837 12:123531019-123531041 AAAGGGAAGAGGAATGGAGGTGG + Intronic
1104309415 12:127640938-127640960 AGAGAGAATTGAAATGAAGATGG + Intergenic
1104509993 12:129368538-129368560 AGGAAGGAGAGGAATGAAGAAGG - Intronic
1104603913 12:130173437-130173459 TCAGAGAAGAGGAAAGAAAAAGG + Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105002679 12:132701459-132701481 GAAGAGAAGAGAAAAGAAGAGGG - Intronic
1105203326 13:18197407-18197429 AGACAGAAGGGGAATGGAGAAGG - Intergenic
1105674897 13:22660572-22660594 ACAGAGAAGACCACTGGAGACGG + Intergenic
1106081559 13:26504971-26504993 AGAGAGAAAAGGAAAGGAGAAGG + Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107167711 13:37301830-37301852 ACAGAGAAGGAGAAAAAAGATGG - Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107791109 13:44003262-44003284 CCAGAGAAGAGCAAGGAAGGGGG - Intergenic
1107895997 13:44964497-44964519 GCGGAGAAGAGGAATCCAGATGG + Intronic
1108205451 13:48084749-48084771 ACAGAAAAATGGAAAGAAGAGGG - Intronic
1108265829 13:48707710-48707732 ATAGAGCAGAGGATTGAAGCAGG - Exonic
1109181602 13:59220180-59220202 ACAGAGAGAAGCAAGGAAGAAGG + Intergenic
1109259098 13:60121879-60121901 AGAGAGAAGATGAATAAAGGAGG - Intronic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110682625 13:78334344-78334366 ACTGAGAAGAGGGATGAATGCGG + Intergenic
1110777560 13:79426557-79426579 AAAAGGAAGAGCAATGAAGAAGG - Intergenic
1110842258 13:80156436-80156458 AAAGAAAAGAAAAATGAAGATGG + Intergenic
1110964039 13:81668754-81668776 AAAGAAGAGAGGAAGGAAGAAGG - Intergenic
1111384093 13:87500859-87500881 ACAGAGAAAAGACGTGAAGACGG + Intergenic
1111397269 13:87678795-87678817 ACAAAGAAAAGGAATGAGAAGGG - Exonic
1111498097 13:89080129-89080151 ACAGAAAAGAGGTATTAAAATGG - Intergenic
1111592404 13:90367184-90367206 TCAGAGAAAAGAAAAGAAGAGGG + Intergenic
1111994540 13:95151522-95151544 AGAAGGAAGAAGAATGAAGAAGG + Intronic
1112188550 13:97151726-97151748 ACAAAGAAGGGGGATGAAAATGG - Intergenic
1112276180 13:98022306-98022328 ACAGACAACAAGCATGAAGATGG + Exonic
1112776663 13:102850858-102850880 TCAGACAGGAGGAAAGAAGAGGG + Intronic
1112803938 13:103141354-103141376 AGAGAAAAGAGGAAGGAAGGCGG - Intergenic
1112980514 13:105378946-105378968 CCAGAGAAGACGAATAAGGATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113240878 13:108335700-108335722 CCAGAGAAGGGGTTTGAAGATGG + Intergenic
1113474432 13:110570280-110570302 ACCGAGGAGAGAAAAGAAGATGG - Intergenic
1113603744 13:111590064-111590086 ACAGAGCAGATGAATGGCGATGG + Intronic
1114143242 14:19941719-19941741 ACAGAGAAAAGGTATGCAGGAGG + Intergenic
1114473269 14:22978096-22978118 ACAGAGGTGAGGAAGGAAGGAGG + Intronic
1114565595 14:23630342-23630364 AAAGTGAACAGGAGTGAAGATGG - Intronic
1114704932 14:24715201-24715223 GCAGAGGAGAGGCATGAATAAGG + Intergenic
1114823133 14:26045732-26045754 AGAGATAATAGGAAAGAAGAAGG - Intergenic
1115277040 14:31620980-31621002 CCAGAGAGGAGGAATCTAGAGGG + Intronic
1115521975 14:34241974-34241996 ACAGAGCAGAAGTGTGAAGAAGG - Intronic
1115728508 14:36242901-36242923 GAAGAGAAGAGGACTGATGAAGG + Intergenic
1116512416 14:45762913-45762935 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
1116641540 14:47469936-47469958 ACAGAGAAGAGATGTGGAGAAGG - Intronic
1116701686 14:48252713-48252735 AGAGAGACCAGAAATGAAGAAGG - Intergenic
1116906308 14:50406951-50406973 ACAAAGAACAGTAATTAAGAAGG - Intronic
1117834272 14:59785968-59785990 ACAGAGACTTGGAAAGAAGAAGG - Intronic
1118259307 14:64232843-64232865 ACAAAGGGGAGGAAGGAAGAAGG + Intronic
1118569033 14:67174020-67174042 ACAATGAAAAAGAATGAAGAAGG + Intronic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1119149591 14:72346354-72346376 AGAGACAAGAGGCATGGAGAAGG + Intronic
1119273328 14:73329452-73329474 AGAGAGAAGAGGACTGAGAAGGG - Intronic
1119606642 14:76023982-76024004 GCAGAAAAGAGGAATGAAGAAGG - Intronic
1119768474 14:77205624-77205646 ACAGAGGGGAGGAATGGAGGGGG + Intronic
1119825900 14:77656857-77656879 GCAGAGTAGAAGCATGAAGAAGG + Intergenic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1119997653 14:79271389-79271411 AAAGGGAAGGGGAAGGAAGAAGG - Intronic
1120465313 14:84849075-84849097 ACAGAGAAGACTAAGGAAAAGGG - Intergenic
1120584228 14:86291152-86291174 AAAGAGAGAAGGAAGGAAGAAGG - Intergenic
1121062640 14:90929757-90929779 ACAGTGAAGAGGGAGGACGAAGG + Intronic
1121264280 14:92589202-92589224 AGAGAGGAGAGAAATGAAGTAGG - Intronic
1121486796 14:94322601-94322623 TCAGAGATGAGGAACAAAGAGGG - Intronic
1121735699 14:96216638-96216660 AGAGAGAAGAGGAAGAAAGAAGG + Intronic
1121957262 14:98225906-98225928 AGAGAGAAGGGGAAAGAAGGAGG - Intergenic
1122015168 14:98789069-98789091 ACAGACAAATGGTATGAAGAAGG - Intergenic
1122407950 14:101511602-101511624 ACACAGAAGAGGAAGGTAAATGG - Intergenic
1123395801 15:19933739-19933761 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1123969808 15:25496768-25496790 ACACTGAAAAGGAATGATGAGGG - Intergenic
1124343415 15:28904584-28904606 AGAGGGAAAAGGAAGGAAGAGGG - Intronic
1124388188 15:29227189-29227211 ACAGAGAACAGGCAGGAAGAGGG + Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124485829 15:30115220-30115242 AAAGAGATGAGGAATATAGAAGG + Intergenic
1124517746 15:30382049-30382071 AAAGAGATGAGGAATATAGAAGG - Intronic
1124540907 15:30584206-30584228 AAAGAGATGAGGAATATAGAAGG + Intergenic
1124622708 15:31284877-31284899 ACACAGCATAAGAATGAAGATGG + Intergenic
1125177936 15:36846938-36846960 TCAGAGAAGAGAAATCAAGAAGG - Intergenic
1125483340 15:40095351-40095373 ACAGTGAGGAGGAAGGAAGTTGG + Intronic
1125523578 15:40361688-40361710 ACTGAGAAGAGGAACTAGGAAGG - Intronic
1126030084 15:44488395-44488417 AAAGAGAATAGAGATGAAGATGG + Intronic
1126178487 15:45761710-45761732 ACAGAGAAGAGGAGGGAATCAGG - Intergenic
1126273580 15:46849394-46849416 AAAGAGAGGAAGTATGAAGATGG - Intergenic
1126291352 15:47083804-47083826 CCAGAGAAGAGAAATAAAAATGG - Intergenic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1126567419 15:50114552-50114574 AGTGAGAAGAGGAAGGAAGATGG - Intronic
1126682116 15:51212570-51212592 ACAGATAAAAGGAACAAAGAAGG + Intronic
1126860494 15:52878161-52878183 ACAGAGAAAAGGGTTAAAGATGG + Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127433912 15:58937694-58937716 ACAGAATAGAGGATTGGAGAAGG + Intronic
1127483685 15:59400182-59400204 ACACTGAAGAGGAATGAATTGGG - Intronic
1127496718 15:59519610-59519632 AAAAAGAAAAGGAAGGAAGAAGG - Intronic
1127561210 15:60138172-60138194 CCAGAGAAGAACAAAGAAGAAGG + Intergenic
1127646370 15:60963382-60963404 GCAGAGATGAGGAATGATGGAGG + Intronic
1127686985 15:61355797-61355819 TCAGACAAGATGAATGAAGAAGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095752 15:64953734-64953756 GAAGAAAAGAGGAAAGAAGAAGG - Intronic
1128352446 15:66900149-66900171 ACTGAGGATAAGAATGAAGAAGG - Intergenic
1128726889 15:69994602-69994624 GCAGAAAAGAGGAAAGAGGAAGG - Intergenic
1128937029 15:71755561-71755583 ATAGATAAGAGAAATGAACAAGG + Intronic
1128990324 15:72254296-72254318 ACAGAGAACAGGAATTGGGAAGG + Intronic
1129107992 15:73322443-73322465 AGAGAAAAGAAGAAAGAAGAGGG + Exonic
1129283254 15:74502678-74502700 ACTGAGAAGAGGAATAAATGGGG - Intergenic
1129718953 15:77867199-77867221 AGAGAGGAGAGGAAAGGAGAGGG - Intergenic
1130458419 15:84138726-84138748 ACACTGAATAGGAATGGAGAGGG - Intergenic
1130726661 15:86446001-86446023 AGAGGGAGGAAGAATGAAGAAGG + Intronic
1130764130 15:86852742-86852764 GCAGGGAAGAGGAATGAGGCAGG + Intronic
1130937572 15:88483186-88483208 ACAGAGTAGGGAAAAGAAGATGG + Intergenic
1131016072 15:89058685-89058707 GCAGGAAAGAGGAATTAAGAAGG - Intergenic
1131031411 15:89189012-89189034 AAAGAGTAGATGAATGAAGTGGG - Intronic
1131318688 15:91366010-91366032 ACAAAGAGGAGGAAGGATGAGGG - Intergenic
1131581813 15:93650698-93650720 TAAGAAAAGAGGAATGTAGAGGG - Intergenic
1131782121 15:95871055-95871077 ACACAGAAGAGGGAAGAACAAGG + Intergenic
1132014759 15:98305730-98305752 AAACAGAAGAGGAAGGAAGAGGG + Intergenic
1133084069 16:3348193-3348215 ACAGTGCAGAGGAATGAGAATGG + Intergenic
1133400066 16:5479279-5479301 ACAGAGATGAGCAATGAACAGGG - Intergenic
1133507923 16:6430444-6430466 CCAGAGAAGAGCTTTGAAGAAGG + Intronic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1133906195 16:10025002-10025024 AGAGAGGAGAGAAAAGAAGAGGG + Intronic
1134068156 16:11242979-11243001 GCTGAGTAGAGGAATGGAGAAGG - Intergenic
1134125658 16:11614266-11614288 AGAAAGAAGAGGAAAGAAGAAGG - Intronic
1134324286 16:13192880-13192902 AAAGAGAAGAAGAAGAAAGAAGG + Intronic
1134350400 16:13432205-13432227 ACAGATAAGAGGAATGAGGGTGG - Intergenic
1134504217 16:14792017-14792039 ACAGAGAACAGGGATGGGGAAGG + Intronic
1134576356 16:15336891-15336913 ACAGAGAACAGGGATGGGGAAGG - Intergenic
1134617369 16:15661924-15661946 AAAGAAAGTAGGAATGAAGATGG - Intronic
1134726087 16:16419610-16419632 ACAGAGAACAGGGATGGGGAAGG + Intergenic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1134835533 16:17357658-17357680 ACAGAGGAGAGCCATGAAGTGGG - Intronic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1134907437 16:17992790-17992812 ACAGAGAAGAAGAAACAAGAAGG + Intergenic
1134941346 16:18292250-18292272 ACAGAGAACAGGGATGGGGAAGG - Intergenic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135397385 16:22141671-22141693 ACAGAGAAAGGGAATGACGTGGG + Exonic
1135425551 16:22332479-22332501 GCAGAGAAGAGGGATGAAAGGGG - Intronic
1136698247 16:32105884-32105906 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136769357 16:32821953-32821975 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136798750 16:33049181-33049203 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136901124 16:34038938-34038960 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136935580 16:34460887-34460909 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136938408 16:34498553-34498575 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136939635 16:34510728-34510750 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136948965 16:34691624-34691646 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136956455 16:34792135-34792157 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136960185 16:34837832-34837854 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136961411 16:34850004-34850026 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136964238 16:34887683-34887705 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136968388 16:34942372-34942394 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137088855 16:36162914-36162936 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137093384 16:36222154-36222176 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137218661 16:46426421-46426443 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1138240228 16:55421566-55421588 ACAAAGAAAAGAAACGAAGAAGG + Intronic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1140054781 16:71516301-71516323 ACAAAGAGGAGTAAAGAAGAGGG + Intronic
1140816551 16:78626544-78626566 ACAGTGAAGAGTCATGATGAAGG - Intronic
1140949831 16:79806441-79806463 ACAAAGAGGAGGAATGAGAAGGG - Intergenic
1141029916 16:80578780-80578802 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
1141089333 16:81119456-81119478 AGAAAGAAGAGGAAAAAAGAAGG - Intergenic
1141614014 16:85200049-85200071 ACAGAGGAGACGAAGGCAGAAGG - Intergenic
1203071773 16_KI270728v1_random:1084058-1084080 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1143247963 17:5501563-5501585 ACAGAGAAAAAAAAGGAAGAAGG - Intronic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143309072 17:5973312-5973334 ACAGAGAAGAGGAAGGAAGGTGG + Intronic
1143370656 17:6436915-6436937 AGAGGGAAGAGGGAAGAAGAAGG + Intergenic
1143512991 17:7406017-7406039 ACAGAGATGAGGAGAGAAAATGG + Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1143892427 17:10112806-10112828 AGAGAGAAAAGGAAGAAAGAGGG + Intronic
1144180565 17:12747618-12747640 AGAGAGAAGAGGAATGAAGGAGG + Intronic
1144227338 17:13162355-13162377 AAAGAGAAAATGAATGAAGTGGG + Intergenic
1144347536 17:14362950-14362972 AGAGAGGAGAGGAGAGAAGACGG - Intergenic
1144378470 17:14669171-14669193 AAAGAGAAGAGGGCTGAAAATGG - Intergenic
1144557207 17:16292800-16292822 ACAGAGTAGAGTAATGAAAAAGG - Intronic
1144909371 17:18668326-18668348 ACAGATCAGGAGAATGAAGAGGG - Intronic
1145692415 17:26756148-26756170 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1145709148 17:26952780-26952802 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1145758080 17:27407532-27407554 ATAGAGGAAAGGAAGGAAGAAGG - Intergenic
1146320128 17:31840461-31840483 CAACAGAAGAGGAATGAATATGG + Intergenic
1146426896 17:32749001-32749023 ACAGAGCTAAGGAATCAAGAAGG + Exonic
1147142559 17:38467503-38467525 ACAGAGAACAGAAAGAAAGATGG - Intronic
1147184004 17:38704104-38704126 ACAGAGAGGAGAAGGGAAGACGG - Intergenic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147462194 17:40580400-40580422 ACATAGAAGGGGAATCAGGAAGG + Intergenic
1148145277 17:45360806-45360828 ACAGGGCAGAGAAAGGAAGACGG - Intergenic
1148507572 17:48140117-48140139 ACAGTGAACAGGAAGGAAGTTGG - Intronic
1148799611 17:50215081-50215103 AGAGAGGACAGGACTGAAGAGGG - Intergenic
1149048453 17:52275635-52275657 AGAGAGAAGAGAGATCAAGAAGG - Intergenic
1149220076 17:54406901-54406923 ACAGAAATGATGAAGGAAGAAGG - Intergenic
1149281578 17:55111080-55111102 ATAGTGAAGAGGAAGGAAAATGG + Intronic
1150091887 17:62333559-62333581 GAAGAGAAGAGGACTAAAGAAGG + Intergenic
1150443358 17:65209686-65209708 AGAGGGAAGAGGCCTGAAGAGGG - Intronic
1150447044 17:65234342-65234364 AAAGGGAAGAAGAAAGAAGAAGG - Intergenic
1150502025 17:65660224-65660246 ACAAAAAAGAGGAAGGAAGGAGG - Intronic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150630803 17:66879098-66879120 ACAGAGAGGAGCAAGGCAGAGGG + Intronic
1150919544 17:69468740-69468762 GCAGAAAAGAGGGATGATGAAGG - Intronic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151995934 17:77609262-77609284 TGAGAGGAGAGGAATGGAGATGG + Intergenic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152386222 17:79976416-79976438 AGAGAGAAGAGGATGGAGGAAGG + Intronic
1152709366 17:81862932-81862954 AAAGTGAGGAGGAATGGAGAGGG - Intergenic
1152791674 17:82283484-82283506 GCAGAGAAGAGGGATGTCGAGGG - Intergenic
1203183936 17_KI270729v1_random:93700-93722 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1153242262 18:3041754-3041776 ACAAACAAGAAGAATGAAGCTGG + Intergenic
1153290207 18:3493863-3493885 ACAGACAAGAAGTGTGAAGAGGG + Intergenic
1153461267 18:5336176-5336198 ACAGAGAAGATGAATCACAAAGG + Intergenic
1153896973 18:9572429-9572451 TCTGAGAAGAGGAAAGAATATGG + Intronic
1153901347 18:9619858-9619880 ACAGAGAAGTGAAATGAGAATGG - Intergenic
1154010174 18:10567577-10567599 ACAGAAAAGTGAAATGCAGAGGG - Intergenic
1154138253 18:11799955-11799977 ATAGGGAAAAGGAATGGAGAGGG - Intronic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1154349454 18:13570751-13570773 AAAGAGAAAAGAAATGAAAAGGG - Intronic
1154461269 18:14590220-14590242 ACAGAGAAAAGGTATGCAGGAGG + Intergenic
1154515811 18:15164443-15164465 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1154519103 18:15207967-15207989 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1155341986 18:24822411-24822433 CCAGAGATGAGAAATGGAGAAGG + Intergenic
1155437309 18:25826709-25826731 AGAGAGAAAAGGAAAGAAGTGGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1156018891 18:32577374-32577396 ACAGAAAAGAGGGAGGAAGAAGG - Intergenic
1156323768 18:36053983-36054005 ACAGGGAAGAGGAATGGGAATGG + Intronic
1156403741 18:36764195-36764217 AGAAAGAAGAGGAGAGAAGAAGG + Intronic
1156491598 18:37499624-37499646 GCAGACAAGAGGCATGCAGAGGG - Intronic
1156585598 18:38427632-38427654 AAAGGGAAGATGAATGAAAATGG + Intergenic
1156728715 18:40162792-40162814 ACAGAGAAGTGAAAGGAAGCAGG + Intergenic
1156868237 18:41913002-41913024 CTAGAGAAGAGGTATGATGATGG - Intergenic
1156935351 18:42699093-42699115 AGAGAAAGGAGGAAAGAAGAAGG + Intergenic
1157071771 18:44416662-44416684 CCAGAGAGGAGGAATCTAGAGGG - Intergenic
1157215326 18:45778117-45778139 AAATTGAAGAGGAATGAAAATGG - Intergenic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157503609 18:48209106-48209128 ACAGAAAAGAGGACAGAAAAGGG + Intronic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157773311 18:50370245-50370267 ACAAAGAAAGGAAATGAAGAGGG - Intergenic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1158003291 18:52644004-52644026 TCAGAGGAAAGGAGTGAAGATGG + Intronic
1158125892 18:54099603-54099625 ACTGAGAAGTGAAATGGAGAGGG - Intergenic
1158470074 18:57728435-57728457 AAAGGAAAGAGGGATGAAGAGGG + Intronic
1158611110 18:58941915-58941937 AAAGAGAAAAGGAAGGAAGGAGG - Intronic
1159352809 18:67298044-67298066 ACAGAGAAAGAGAATAAAGATGG - Intergenic
1159688364 18:71453000-71453022 AAAGAGAAAATAAATGAAGAAGG + Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1160066973 18:75584401-75584423 AAAGAGAAGAGGAATAAATGAGG + Intergenic
1160227006 18:77019406-77019428 ACAGGGGAGAGGTGTGAAGATGG + Intronic
1160478506 18:79216688-79216710 ACAGGGAAAAGAAAAGAAGAGGG - Intronic
1160607776 18:80065418-80065440 ACAGAAAAAAGGAATGAGGAAGG + Intronic
1161280367 19:3442338-3442360 ACAGAGGAGAGGAATGGATGGGG - Intronic
1161993448 19:7698420-7698442 GGAGAGAAGAGGAGTGGAGAGGG + Intronic
1162024139 19:7884318-7884340 AAAAAAAAGAAGAATGAAGAAGG + Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162622138 19:11852122-11852144 ACAGAGATCAGTAGTGAAGAGGG + Intronic
1162626962 19:11892454-11892476 ACAGAGATCAGTAGTGAAGAGGG + Intronic
1162631254 19:11928776-11928798 ACAGAGATCAGTAGTGAAGAGGG + Intronic
1162904539 19:13815987-13816009 AGAGAGAAGAGGAAAGAAAGAGG + Intronic
1163004091 19:14386707-14386729 AAAAAAAAGAGAAATGAAGATGG + Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163176018 19:15564432-15564454 ACAGAGAGGAGGAATGAATCCGG - Intergenic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164546283 19:29166392-29166414 ACAGAGCAGAGGAAAGAGCATGG + Intergenic
1164833230 19:31339243-31339265 AAAGAGAAAAGGAATGAGAAAGG + Intronic
1164903481 19:31947815-31947837 AGAGAGCAGAGGAAGGACGAGGG + Intergenic
1165101381 19:33440521-33440543 GCAGAGGAGAGGACTGAAGGTGG - Intronic
1165170026 19:33885636-33885658 TCACAGAAGAGGTATGAAAAAGG - Intergenic
1165281261 19:34799718-34799740 ACAGGGAAGAGAAAGGAAAAGGG - Intergenic
1165456584 19:35915000-35915022 AAAGAAAAAAGGAAGGAAGAAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165854511 19:38871432-38871454 ACAGAGGAGAGGATTGGAGGAGG - Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166165253 19:40983199-40983221 ACACAGAAGGGGATAGAAGAGGG + Intergenic
1166300668 19:41910404-41910426 ACAGTGAGGAGGAATGGGGAGGG + Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167110582 19:47458287-47458309 AGAGAGATGGGGAAAGAAGAGGG - Intronic
1167418908 19:49391256-49391278 ACTGTGAAGAGAAATGAAGCGGG - Intronic
1167461693 19:49628116-49628138 ACAAAAAAGAGGGATGAGGAAGG - Intergenic
1167607380 19:50488632-50488654 CCAGAGAAGAGGAAAGAGAAAGG + Exonic
1167665446 19:50820780-50820802 CCAGGGAAGAGGGAGGAAGAGGG + Intronic
1167957848 19:53082110-53082132 AAAAGGAAGAGGAAGGAAGAGGG + Intronic
1168312865 19:55470006-55470028 AGAGAGGAGAGGAAAGGAGAAGG + Intergenic
1168612170 19:57810118-57810140 AAAGAGAAGAGGAGAGGAGAGGG + Intronic
1202682412 1_KI270712v1_random:19066-19088 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
925052770 2:830215-830237 GCAAAGAGGAGGAATGAAGCTGG - Intergenic
925593912 2:5536637-5536659 AGAAAGAAGAGGAATGAAGGAGG - Intergenic
926421196 2:12701582-12701604 ACAGAGAAGAGCAAAGAAGAAGG - Intergenic
926477500 2:13343535-13343557 ACAGAGCAGAGGAAGAAACAGGG + Intergenic
926510735 2:13774406-13774428 ACAGAGAATAAGAAAGAAGTTGG - Intergenic
926786076 2:16519610-16519632 AAAGTGATGAGGAATAAAGAAGG - Intergenic
926877974 2:17506449-17506471 AAAGAGAATAGCAAAGAAGAGGG + Intergenic
926934041 2:18069003-18069025 GCAGAGTAGAGGCATGGAGAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928859059 2:35833907-35833929 ACAGAGAAAAGGAAGGAAAGGGG + Intergenic
929164215 2:38864809-38864831 AGAGAGAAGAGGAAAGAAAATGG - Intronic
929327628 2:40636495-40636517 ACAGAGAAGAGAATTAAACAAGG - Intergenic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929662331 2:43799367-43799389 TCAGAGAAGAGCCATGAGGATGG + Intronic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930031111 2:47058623-47058645 ACACAGATGAGGAACGCAGAAGG - Intronic
930440570 2:51399165-51399187 ACAGAGAAAGGGAAGGATGAAGG - Intergenic
930517322 2:52424392-52424414 AAAGAGAAAAGGAAGGAAGGAGG + Intergenic
930657717 2:54022785-54022807 AGAGACAAGGGGAATGGAGAGGG - Intronic
930729795 2:54717337-54717359 ACAGAAAGGAGAAATCAAGATGG - Intergenic
931251356 2:60533349-60533371 AAAGAGAGAAGGAATGAAGGGGG + Intronic
931436073 2:62248156-62248178 AGAGATAAGAGGGAAGAAGAAGG - Intergenic
932140483 2:69273112-69273134 ACAGATTAGAGGAATGAAGCTGG + Intergenic
932795358 2:74690463-74690485 AGAATGAAGAGAAATGAAGATGG + Intergenic
933194472 2:79372606-79372628 ACAAAGAAGAGAAAAGAAAAGGG + Intronic
933233056 2:79831034-79831056 ATTGAGAAGAGGAAAAAAGAGGG - Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
934059479 2:88280787-88280809 ACATAGAATAGGAATGTACATGG + Intergenic
934098591 2:88629551-88629573 AGAGGGAAGAGGAAGTAAGAGGG - Intergenic
934121818 2:88847577-88847599 ACAGAGAAGAGGGAAGGAAAAGG + Intergenic
934623330 2:95829702-95829724 ACAGTGAGGAGGAATGAATCCGG + Intergenic
934810429 2:97272389-97272411 ACAGTGAGGAGGAATGAATCCGG - Intergenic
934827263 2:97435550-97435572 ACAGTGAGGAGGAATGAATCCGG + Intergenic
935128377 2:100243219-100243241 TCAGAGCAGATGAATGAAGGTGG - Intergenic
935175340 2:100643974-100643996 ACAGAGGAGAGGAAGGGAGCAGG - Intergenic
935210403 2:100934997-100935019 AGAGAGAAGAGGGAAGAAGACGG - Intronic
935801378 2:106700148-106700170 GCTGAGGAGAGGAATGCAGAAGG + Intergenic
935888259 2:107648269-107648291 ACACAGAAGAGGGCTGAAGTGGG + Intergenic
935917699 2:107973879-107973901 GCAGATAAGAGAAATGAGGAAGG + Intergenic
936235285 2:110737219-110737241 AAAGAAATGAGGGATGAAGAGGG - Intronic
936324098 2:111490155-111490177 ACAGAAGAGAGGAAGGAAGTGGG - Intergenic
936392308 2:112086722-112086744 ACAGAGCTGAGGAATGAGGGAGG - Intronic
936448880 2:112618529-112618551 AGGGAAAGGAGGAATGAAGAAGG + Intergenic
936501668 2:113071776-113071798 TGAGAGAAGAGAAAGGAAGAAGG - Intronic
936926561 2:117742916-117742938 AAAGCAAAGAGGAAAGAAGAAGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937057674 2:118953136-118953158 ACAGGGAAGAGCAAAGAAGTTGG + Intronic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937498280 2:122449383-122449405 AAAGAGAAGAAGGATCAAGATGG + Intergenic
937536027 2:122888313-122888335 GCAGTGAAGAGAAATGTAGAGGG + Intergenic
938046445 2:128125556-128125578 AAAGAGAACAGGAAAGAAAAAGG - Intronic
938317508 2:130340276-130340298 ACAGAGCAGAGGGAGGAAGTAGG - Intronic
938516071 2:132009205-132009227 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
938519105 2:132048521-132048543 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
939124556 2:138161108-138161130 ACAGATAAGAGGAAAGTAAAAGG + Intergenic
940420145 2:153471431-153471453 ACAGAGAAGAGAAATAGAGAAGG + Intergenic
941065965 2:160903123-160903145 AAAGAGAATAAGCATGAAGAAGG - Intergenic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941772639 2:169361537-169361559 ACAGAGAAGAGGGAAAGAGAGGG - Intronic
941873133 2:170406593-170406615 GCAGAAAAGAGGAATGGGGAGGG - Intronic
942169411 2:173275414-173275436 AGAGTGGAGAGGAATGCAGAAGG - Intergenic
942640626 2:178057670-178057692 GTAGAGAAGAGGAATGAACAAGG - Intronic
942671398 2:178379438-178379460 AGAGAGAAAAGGAAGGAAGGAGG + Intronic
942737114 2:179126948-179126970 ACAGAGACTAGCAATGAAAATGG - Intronic
943015578 2:182506178-182506200 AAAGAAAAGATGAATGACGAAGG - Intronic
943232222 2:185268833-185268855 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
943473178 2:188320712-188320734 ACATAGAAGATGAATGTTGAAGG - Intronic
943760289 2:191600776-191600798 GCAGAGGAGAGGGAGGAAGAGGG - Intergenic
943775495 2:191761744-191761766 AAAGAAAAGAGTAATGAATAAGG - Intergenic
944105371 2:196073866-196073888 AGATAGCAGAGGATTGAAGAAGG - Intergenic
944218896 2:197282577-197282599 ACAGAGAAGATGCTTGAAGTTGG + Intronic
944413162 2:199461811-199461833 AGAGAGAAAAGGAGAGAAGATGG - Intronic
944501577 2:200365640-200365662 ACAGTGAAGAAGAAAGAAAAAGG - Intronic
945148506 2:206763799-206763821 ACAGAGAAGAGGTAGAAAGGAGG - Intronic
945368740 2:208990044-208990066 ACAGATAGGAGGAATAAATATGG + Intergenic
945607177 2:211949154-211949176 ACCTAGATGAGGAATGATGATGG - Intronic
945732925 2:213563058-213563080 ACATAGAAGATGAATACAGAAGG - Intronic
946013980 2:216589024-216589046 AAAGAGCAGAGTAATGAAGATGG + Intergenic
946124876 2:217553747-217553769 ACAGAGAGAAGGAAGGAAGGAGG - Intronic
946287373 2:218714222-218714244 AGAGCAAAGAGGAAGGAAGAAGG + Intronic
946471016 2:219961026-219961048 ATAAAGGAGAGGGATGAAGAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946809882 2:223512474-223512496 AGAGAAAAGATGAATGAAGGAGG + Intergenic
946862658 2:224014863-224014885 AGAGAGAATAGGCATGAAAAGGG + Intronic
947073241 2:226314913-226314935 GCAGAGAAGAGGGAAGAAGGAGG + Intergenic
947095363 2:226561053-226561075 ACTGGGAAGAGGAGTGAAGTTGG - Intergenic
947182919 2:227428068-227428090 AAAGAGAAGAGAAAAGAAGAAGG - Intergenic
947220863 2:227791219-227791241 ACAGAAAAGAGGGAGGAGGAAGG + Intergenic
947283957 2:228489244-228489266 ACACAGAGAAGGAAAGAAGAAGG + Intergenic
947293615 2:228605338-228605360 AAAGTGAAAAGGAGTGAAGAGGG + Intergenic
947340630 2:229134990-229135012 ACAAAGAAGAAAAACGAAGATGG + Intronic
948413230 2:237781038-237781060 ACAGGAAAGAGGAAGGAAGCTGG + Intronic
949077934 2:242073269-242073291 CCGGTGAAGGGGAATGAAGAAGG + Intergenic
1168871234 20:1130483-1130505 AGAGGGAAGAGGTCTGAAGAGGG - Intronic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169709736 20:8548106-8548128 AAAAAGAAAAGGAAGGAAGAAGG - Intronic
1170193944 20:13671335-13671357 AAAGAAAAGAAGAAAGAAGAAGG - Intergenic
1170354435 20:15477071-15477093 ATAGAGAAAAGGAATGGAAAAGG - Intronic
1170500566 20:16971889-16971911 AGAGAAAAGTGGAAGGAAGATGG - Intergenic
1170776387 20:19378323-19378345 AAAGAGAAGAGGAATAAATAAGG + Intronic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171419318 20:25007468-25007490 AGAGGGCAGAGGAATGGAGATGG + Exonic
1171422419 20:25026087-25026109 AGAGGGAAGACAAATGAAGAGGG + Intronic
1172590150 20:36112131-36112153 ACAGGGTAGAGGATGGAAGAGGG - Intronic
1172621799 20:36322254-36322276 TCAGGGAAGAGGAAGGAAGATGG + Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173243167 20:41316248-41316270 ACATAGAAAATGAATGAAAAGGG - Intronic
1173440112 20:43068146-43068168 AGAGAGAAAAGGAAGGAAGGAGG + Intronic
1173521138 20:43701232-43701254 ACGGAGCAGAGGAGGGAAGATGG - Intronic
1174466044 20:50718214-50718236 ACACAGAAGAGGACAGAAGAGGG - Intergenic
1175234820 20:57502608-57502630 TCAGAGGAAAGGAATGGAGAAGG + Intronic
1175414453 20:58792638-58792660 ACGGGGAAGGGGAATGGAGATGG + Intergenic
1175426649 20:58871666-58871688 AGAGAGAGGAGGAAAAAAGAGGG + Intronic
1175426653 20:58871694-58871716 AAAGAGAGAAGGAAGGAAGAAGG + Intronic
1175686063 20:61029714-61029736 GCAGAGGAGAGGAAGGGAGAAGG - Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176585912 21:8584977-8584999 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1176714638 21:10340611-10340633 AGACAGAAGGGGAATGGAGAAGG + Intergenic
1176742610 21:10617664-10617686 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1176813238 21:13567628-13567650 ACAGAGAAAAGGTATGCAGGAGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1176936815 21:14876865-14876887 ACAAAGAAGAAGGAAGAAGAAGG - Intergenic
1177439583 21:21103994-21104016 ACAGAGTAGAAGAACAAAGAAGG + Intronic
1177544921 21:22544314-22544336 ACAGAGAAAAGGAGCAAAGATGG - Intergenic
1177906264 21:26974472-26974494 ACAGAGATGAGAAAGGGAGAAGG + Intergenic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178635753 21:34301210-34301232 ACAGAGAATGGGGAGGAAGATGG + Intergenic
1178676046 21:34632601-34632623 ACAGAGAAGTCAAAGGAAGAAGG + Intergenic
1178684193 21:34698391-34698413 AGAGACAAAAGGAATGAAGGAGG + Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179340521 21:40504160-40504182 GAAGAGAAGAGGAAAGAAGAGGG + Intronic
1179453794 21:41484230-41484252 ACAGAAAAGAGAAAAGAAAATGG - Intronic
1179634131 21:42696586-42696608 ACTGAGAAGAGGAAGGAAGGAGG + Intronic
1179707267 21:43188848-43188870 AGAGAGAAGAGGAGTTAAGAAGG - Intergenic
1179936316 21:44606864-44606886 CCAGAGGAGAGGAATGGGGAAGG + Intronic
1180057916 21:45368539-45368561 ACTTAGAAGAGGAGAGAAGAGGG + Intergenic
1180097060 21:45560678-45560700 ACCAAGAAGAGGAATGACAAAGG + Intergenic
1180268719 22:10561882-10561904 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1180525486 22:16255136-16255158 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1180899540 22:19360450-19360472 ACAGTGCAGAGGAATGAAGCAGG - Intronic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182011213 22:27002211-27002233 ACTTAGAAGAGAAAGGAAGAAGG + Intergenic
1182083182 22:27543511-27543533 ACAGGGAGGAGGGAGGAAGAAGG - Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1182702742 22:32253681-32253703 ACAGAGAGGAGCCATGAAGTCGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183315062 22:37132473-37132495 ACAGAGGAGAGGAGGGAAGGAGG + Intronic
1183850326 22:40580641-40580663 ACAGGACAGTGGAATGAAGAGGG - Intronic
1183878162 22:40802182-40802204 GCAGAAAAGAGGGATGAAGGTGG - Intronic
1184028118 22:41873248-41873270 ACAGAGATGAAGAATAAAAAGGG + Intronic
1184714210 22:46271511-46271533 ACAGAGAAAAGGAAAAAAAAAGG - Intronic
1184907480 22:47498623-47498645 ACAATGGAGAGGAATGAGGAGGG + Intergenic
1184967770 22:47993944-47993966 ACAAAGAAAAGCAAGGAAGAAGG + Intergenic
1185179893 22:49353181-49353203 ACAGAGAAGAGGAAGGAGTGAGG - Intergenic
1185198473 22:49487908-49487930 AAAGAGGAGAGGAAAAAAGATGG - Intronic
1185230782 22:49679697-49679719 ACAGAGAAATGGGAGGAAGATGG + Intergenic
1203290025 22_KI270735v1_random:27761-27783 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1203322881 22_KI270737v1_random:85785-85807 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
949108639 3:231292-231314 AGAGAGGAGAGGAAGGAGGAAGG - Intronic
949284836 3:2389558-2389580 AAAGGAAAGAGGAATGAAGGAGG - Intronic
949710881 3:6870001-6870023 AAAAAGAAGAGGAAAGGAGAAGG - Intronic
950032230 3:9860706-9860728 ACCTAGAAGAGGAATCAGGATGG - Intergenic
950063036 3:10088151-10088173 ACAGAGAAAAGGAATGCTGCTGG - Intronic
950415381 3:12866246-12866268 ACCTAGAAGAGGAATCAGGATGG - Intronic
950417011 3:12874534-12874556 ACCTAGAAGAGGAATGAAGATGG - Intergenic
950471307 3:13188199-13188221 ACAGAGAATAGGAATGGGGTAGG - Intergenic
950608370 3:14105950-14105972 AAAGAGAAGAGAAAGGAAGTAGG + Intergenic
951030937 3:17881186-17881208 ACAGAGAAGAGAAATAAAGCAGG + Intronic
951388720 3:22075472-22075494 AAAGTGAAGAGGGATGATGAGGG - Intronic
951412242 3:22379384-22379406 AAAGAGAGGAGGAAGGAAGGAGG + Intergenic
951639243 3:24816410-24816432 GGAGAGAAGAGGATGGAAGAAGG - Intergenic
951661260 3:25069131-25069153 AAAGAGAAGGGTAAGGAAGAAGG + Intergenic
951990135 3:28667578-28667600 ACAGAAAAGAGGGGTGAGGAAGG - Intergenic
952064156 3:29547517-29547539 AAAGACAAGAGGAAAGAAAATGG + Intronic
952218680 3:31302805-31302827 ACAGAGAAGAGGAAAGGGCAGGG - Intergenic
952406385 3:33008750-33008772 ACATGGAGGAGGAATGAAGGAGG + Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952679592 3:36075074-36075096 AACTAGAAGAGGAGTGAAGATGG - Intergenic
953209459 3:40862869-40862891 TCAGAGAAGAGGGATGAACCTGG + Intergenic
953390288 3:42529972-42529994 ACTGAGAAGAGGGTGGAAGAGGG - Intronic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953718969 3:45338874-45338896 ACAGAGAAGTGGAGAGAAGCTGG + Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954082860 3:48222623-48222645 ACAGTGAAGAAGGATGCAGAAGG + Intergenic
954295016 3:49669570-49669592 ACAGAGGAGAGGCATGAAACAGG - Exonic
955156591 3:56422546-56422568 ACAGAGAGCAAGAACGAAGAAGG - Intronic
955529769 3:59860990-59861012 GAAGAGAAGAGGAAGAAAGAGGG + Intronic
955747626 3:62155799-62155821 AATGAGAAGAGGAAGGAAGGAGG + Intronic
956105115 3:65809482-65809504 ACAGAGAAGAGAAATGAATGGGG + Intronic
956203213 3:66728976-66728998 ACAAAAAAGTTGAATGAAGATGG - Intergenic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956693880 3:71902293-71902315 AAAGAAAATTGGAATGAAGAAGG - Intergenic
956962194 3:74416027-74416049 TTAGAGAAAAGGAATGGAGATGG - Intronic
956989372 3:74745454-74745476 ATAGGAAAGAGGAAGGAAGAAGG - Intergenic
957206235 3:77202662-77202684 AGAGAATAGAGGAAGGAAGATGG - Intronic
957273500 3:78061424-78061446 ATATAGAAGAGAAATTAAGAAGG - Intergenic
957384523 3:79478712-79478734 GTAGAGAACAGTAATGAAGAAGG - Intronic
957459223 3:80495883-80495905 AAAGGGAAGAAGAATGAATATGG + Intergenic
957563141 3:81850869-81850891 ACAGTGAAGTGGAAAGAATATGG - Intergenic
957729634 3:84117097-84117119 AGAGAGAATAAGGATGAAGAAGG - Intergenic
957825050 3:85430675-85430697 ACAGAGAAAAGAAACAAAGAGGG + Intronic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
958899842 3:99872769-99872791 TCAGAGAACAAGCATGAAGAGGG + Intronic
958900908 3:99885734-99885756 GCAGAGAGGAGGGAAGAAGAAGG - Intronic
959069571 3:101689892-101689914 ACAGATAAGAGGAAGGGAGTAGG + Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960252939 3:115476915-115476937 ACAGATAAGAGCAAGGGAGATGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
960923062 3:122767901-122767923 ACAAAGAAGGGGCAGGAAGAAGG + Intronic
960928611 3:122821367-122821389 TCAGAGAAGAGGGAAGAAAAGGG + Intronic
961527027 3:127510717-127510739 ACAGAGAAGAGGAAAGACCTGGG + Intergenic
962034336 3:131635712-131635734 ACAGGGGAGAGGGATGAAGATGG + Intronic
962055440 3:131866419-131866441 CCAGAGAGGAGGAATGAGAAAGG + Intronic
962135925 3:132731912-132731934 AGAGAGAAGATGAAAGAACAGGG - Intergenic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962685600 3:137844968-137844990 ACAGGGAAGAGGGAGGGAGAGGG - Intergenic
962864954 3:139440801-139440823 TGAGAGGAGGGGAATGAAGAAGG + Intergenic
963098021 3:141566376-141566398 ACAGAGAGGATGAAGGAATATGG + Intronic
963179204 3:142336418-142336440 AAAGAGAAGAGGAAAAAGGAAGG + Intronic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
963776063 3:149442064-149442086 AAAGATAAAAGGAATTAAGATGG - Intergenic
963950665 3:151196496-151196518 AAAGAGAAGAGGACTAAAGGGGG + Intronic
964314247 3:155426533-155426555 AAAGAGAGGAGGAAGGAAGAGGG - Intronic
964374412 3:156035469-156035491 AAAGAGAAGAAGGAAGAAGAAGG - Intergenic
964390523 3:156191986-156192008 ATAGAGAAGAGGAACAGAGAGGG - Intronic
964744476 3:159999410-159999432 ACAGAGAAGAGGACTTATGATGG - Intergenic
965360721 3:167735219-167735241 ACAGAGCAGAGGAAGGAAGGGGG + Intergenic
965632040 3:170742962-170742984 ACAGGGAAGTGGAAAGCAGAAGG - Intronic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965898192 3:173604778-173604800 AAAGATAAGAGGGATTAAGAAGG + Exonic
965967644 3:174513959-174513981 ACAGAGAAGAGGGCTGACAAGGG - Intronic
966063969 3:175794686-175794708 ATAGAGCAGAGGACTGTAGAGGG - Intronic
966230986 3:177651756-177651778 ACAGAACAGAGAAATTAAGATGG - Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966403636 3:179572126-179572148 CATGAGAAGAGGATTGAAGATGG + Intronic
967104035 3:186241186-186241208 ACAAAGAGTAGGAATGAAAATGG + Intronic
967185401 3:186940346-186940368 AAAGAGAAGTGGAATGAGGGAGG - Intronic
967533160 3:190572414-190572436 AGAGAAAAGAGGAATAATGAGGG + Intronic
968294442 3:197563406-197563428 AGAGAAAAGAAGAATGAACAAGG + Intronic
969159152 4:5240037-5240059 AGAGAGAAGAGAAATGAAGGGGG - Intronic
969925259 4:10579369-10579391 GAAGAAAAGAGGAAGGAAGAGGG + Intronic
969949230 4:10816941-10816963 ACAGAAAAGTGGAAGAAAGATGG - Intergenic
970116651 4:12704516-12704538 AAATAGAAGAGCAAGGAAGAAGG + Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970539968 4:17067836-17067858 ACAGAGGAGCTTAATGAAGAGGG - Intergenic
970973791 4:22019223-22019245 AAGGAGAAGAGGAAAGAAAATGG - Intergenic
971053041 4:22882555-22882577 ACTAGGAAGAGGAATGTAGAAGG - Intergenic
971069364 4:23073564-23073586 ACAGAGAAGAGGGATGAGTGTGG + Intergenic
971923388 4:32972937-32972959 ACAAAGCAGATGAAAGAAGAGGG - Intergenic
972427675 4:38949685-38949707 CCAGAGAAGGGGAAGGGAGAAGG - Intergenic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
972962363 4:44469579-44469601 ACAGAGAAGTGAGATGAAAAGGG + Intergenic
973319711 4:48797537-48797559 AGACAGAAGAGAAAGGAAGAAGG + Intergenic
973531281 4:51839092-51839114 AGAGAGAAAAGGAAGGAAGAAGG + Intergenic
973619039 4:52709519-52709541 ACAGGGAAGCTGAATGAAGGTGG + Intergenic
973662806 4:53125419-53125441 AAAGAGAATAAGAATGAAAAAGG - Intronic
973835310 4:54803552-54803574 ACAGACAAGAGGGCTGGAGAAGG + Intergenic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
973910627 4:55576640-55576662 ACACAGAAAATGAAAGAAGAAGG + Intronic
973934236 4:55826959-55826981 GGAGAGAAGAGACATGAAGAAGG - Intergenic
974523887 4:63022207-63022229 GCAGAGAAAAGGAATAAATATGG + Intergenic
974714441 4:65649126-65649148 AGAGAAAAGAAGAATGAATATGG + Intronic
974738274 4:65969753-65969775 ACAGAGAAAATGAATGAACTTGG - Intergenic
974813980 4:66982184-66982206 CCAGAGAGGAGGAATCTAGAGGG - Intergenic
975182192 4:71359001-71359023 AAAAAGAAGTGGAATGAATATGG + Intronic
975664971 4:76726496-76726518 AGAGAGAAGAGGAAATAAGCAGG - Intronic
975914140 4:79303046-79303068 CAAGAGAACAGGAATGAAAAGGG - Intronic
976234828 4:82885705-82885727 AAAGAGAAGAGGAAAGAAATTGG - Intronic
976439598 4:85058193-85058215 AAAGGGAGGAGGAATGGAGAGGG - Intergenic
976830743 4:89310745-89310767 ACAGAGGAGAAGGATGAATAAGG - Intergenic
977685463 4:99842486-99842508 ACAGATAAGAGGAATAAAGCTGG - Intronic
977986941 4:103393995-103394017 ACAGAAAGCAGGAATAAAGATGG - Intergenic
978113593 4:104992334-104992356 AAAGAGGAAAGGAAGGAAGAGGG - Intergenic
978165374 4:105601004-105601026 ACAGGGTAGAGGAAGAAAGATGG - Intronic
978233095 4:106424386-106424408 GCAGAGAAGGGGACAGAAGAGGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978444256 4:108765428-108765450 AGAGTGAAGAGAAAAGAAGAGGG - Intergenic
978844118 4:113251883-113251905 ACAGAGAAGATGAATTAATCAGG + Intronic
979435411 4:120683007-120683029 ACCAAGAAGAGCAATGAAGAAGG - Intergenic
980166815 4:129239183-129239205 ACAGAGCAAAGGAAAGCAGATGG - Intergenic
980823385 4:138044687-138044709 ACATAAAAAAGGAATAAAGAAGG + Intergenic
981091453 4:140736659-140736681 ACAGAGAACAGGAAGAAAGAGGG + Intronic
981116861 4:141001366-141001388 GTAGAGAAGACAAATGAAGAGGG - Intronic
981601559 4:146494649-146494671 ACAGAAAAGATGAGTGGAGATGG - Intronic
982102879 4:151985524-151985546 ACAAAGAAGAGGAATGGAAGTGG + Intergenic
982121582 4:152148442-152148464 ACAGAGAGGAGGAATGCTGCTGG - Intergenic
982738870 4:159037014-159037036 GCTGAGAAGAGAAAGGAAGAAGG + Intronic
982740645 4:159053739-159053761 AGAAAGAAGAGGAAGGAAGGAGG - Intergenic
982823257 4:159970841-159970863 ACAGAAAAAAGAAATGAAGAAGG - Intergenic
983197776 4:164826574-164826596 GCAGAGAAGAGAAGAGAAGAAGG + Intergenic
983339367 4:166438613-166438635 CTAGAGGAGAGGAAAGAAGAAGG - Intergenic
983370056 4:166846459-166846481 ACAGTGAATAGGAATAAATATGG + Intronic
983411127 4:167399452-167399474 ATAGAGCACAGGAAAGAAGAAGG - Intergenic
983794284 4:171840814-171840836 AGAAAAAAGAGGAATTAAGATGG - Intronic
984090489 4:175368420-175368442 GCACAGAAGAGGCAGGAAGAAGG + Intergenic
984128667 4:175844888-175844910 CCTAAGAAGAGGGATGAAGAGGG + Intronic
984143153 4:176027828-176027850 CCAGTTAAAAGGAATGAAGAAGG - Intergenic
984466547 4:180106825-180106847 TCAGAGAAGAGGACTGCAGAAGG + Intergenic
984579031 4:181488387-181488409 ACAGAGATGAGAAATCAGGAGGG - Intergenic
985169095 4:187129120-187129142 AAACAGAAAAGGAAGGAAGAAGG + Intergenic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
985374469 4:189320361-189320383 TCAGATAAGAGGAAGGAATAAGG - Intergenic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985992277 5:3573243-3573265 ACAGAGAAGGAAAATAAAGAGGG + Intergenic
986219828 5:5758103-5758125 GCAGATATGAGGACTGAAGAAGG - Intergenic
986601043 5:9473596-9473618 AGAGAGAGGAGGAAAGAAGGAGG + Intronic
988330364 5:29830284-29830306 TCAAAGAAGAGGAAACAAGATGG + Intergenic
988468007 5:31509519-31509541 AAAGAAGAAAGGAATGAAGAGGG + Intronic
989150222 5:38291594-38291616 AAATAGAAGTGGAATGAAAATGG + Intronic
989269359 5:39513888-39513910 CCAGTGAAGAAGAATGAAGATGG - Intergenic
989353235 5:40512476-40512498 ACAGAGAAGTTGAATGGAAATGG + Intergenic
989467883 5:41778438-41778460 AGAGAGAAGAGGTCTGGAGATGG + Intronic
989507642 5:42245987-42246009 AAAGAGAAGAGCAAATAAGAAGG - Intergenic
989661711 5:43806258-43806280 TCAGTTAAGAGGAATGAACATGG + Intergenic
989687598 5:44108233-44108255 CCAGAGAGGAGGAATCTAGAGGG + Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990013422 5:51027606-51027628 ACAAAGGAGAGGAGTGAGGAGGG + Intergenic
990145290 5:52753006-52753028 ACAGAGATTTGGAATGAATAAGG + Intergenic
990717892 5:58659039-58659061 TCATAAAAGGGGAATGAAGACGG + Intronic
990993420 5:61707435-61707457 AGAGAGCATAGGAATAAAGATGG - Intronic
991472619 5:66985169-66985191 TCAAAGAAGCGGAATGAAGGAGG + Intronic
991474133 5:67001986-67002008 ACAGAGAAGAGTAATCAAGGTGG - Intronic
991930864 5:71751321-71751343 AGAGAGAAGAGATTTGAAGAAGG - Intergenic
992184604 5:74231972-74231994 ACAGAGATGAGTGATGAAGCTGG + Intergenic
992926332 5:81591845-81591867 ACAGAGAGGAGGAGCCAAGATGG + Intronic
992946371 5:81814806-81814828 ACAGAGGAGGGGTTTGAAGAAGG + Intergenic
992952222 5:81871316-81871338 AGACAGAAGAGGAATGAAAGGGG + Intergenic
993065631 5:83094416-83094438 AAAGAGGAAAGGAAAGAAGAGGG - Intronic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993428216 5:87797111-87797133 ACAGAGAGAAGGAAAGAAAATGG + Intergenic
993464569 5:88229597-88229619 ACAGGGAAAAGCAATGAATAAGG + Intronic
993622383 5:90184001-90184023 ACAGAGAAAAGGAAGCATGAAGG + Intergenic
993827398 5:92708755-92708777 TAAGAGAAGAGGAAGGCAGAGGG + Intergenic
993895013 5:93523291-93523313 CCAGAGAGGAGGAATCCAGAAGG - Intergenic
994200865 5:96974329-96974351 ACAGAGAAGAGGCATGTGCATGG - Intronic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995162473 5:108997828-108997850 CCAGAGAGGAGGAATCTAGAGGG + Intronic
995701148 5:114937457-114937479 GAAGAGAAGAGGAGAGAAGAGGG + Intergenic
995709361 5:115019355-115019377 ACTGTGATGAGGGATGAAGATGG - Intergenic
996391851 5:122970858-122970880 ACAGAGATGAGAAAAGAGGAGGG - Intronic
996425844 5:123312939-123312961 TCAGTGAAGAGGAATGAATCAGG + Intergenic
996633833 5:125666986-125667008 AGAGAGAGGAGGGAGGAAGAGGG + Intergenic
996711360 5:126546580-126546602 ACAGAAAAAAGGAATTAAGAGGG + Intronic
996749966 5:126878412-126878434 ACAGAGAAGAGCAAGGGAGAGGG + Intronic
996847600 5:127917593-127917615 CCAGAGAAGAGGGAGAAAGATGG + Intergenic
996859957 5:128054177-128054199 ACTGAGCAGACGAATGCAGAGGG - Intergenic
996912930 5:128676280-128676302 ACAGAGAAGGGAAAGGAAAATGG - Intronic
997680358 5:135746036-135746058 ACAGGGAGGAGGACTGTAGAAGG - Intergenic
997789762 5:136747924-136747946 AAATAGAAGAGGAAGGCAGATGG + Intergenic
997896292 5:137720584-137720606 ACTGTGAACAGGAAGGAAGAGGG + Exonic
998265875 5:140667402-140667424 GCAGAGATAAGGAATGAGGAGGG - Intronic
998298337 5:140993430-140993452 AAGGAGAACAGGAATGAATAAGG - Intronic
998369201 5:141650465-141650487 CCAGAGTAGAGGACTGAGGATGG - Intronic
998397895 5:141831132-141831154 ACAGAGACAAGGAAGGAAGATGG + Intergenic
998621220 5:143796214-143796236 AGAGAGAAGAGGAGAGAAGGAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998958105 5:147457561-147457583 TCAGAGCAGATGAATTAAGATGG + Intronic
999039712 5:148393955-148393977 GGAGAGAGGAGGAATGGAGAGGG - Intronic
999090456 5:148931693-148931715 AAAGAGAAGAGGAAGGAAATAGG - Intronic
999091351 5:148939034-148939056 AGAGACAAGAGGACTGAAGAGGG - Intronic
999139503 5:149348942-149348964 AGAGAGAAAAGGACTAAAGAGGG + Intronic
999349222 5:150851307-150851329 ACAGATAAGGGGGAGGAAGATGG - Intronic
999504868 5:152184170-152184192 AGAAAGAAAAAGAATGAAGAGGG + Intergenic
1000407975 5:160908773-160908795 TCTCAGCAGAGGAATGAAGATGG - Intergenic
1000431528 5:161158318-161158340 AGACAGAAGAGGAAAGAACACGG + Intergenic
1000441703 5:161271490-161271512 AAAGAGTAGAGGAAGGAAGAAGG + Intergenic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1000680989 5:164184398-164184420 AAAGAAAAGAGGACTGAAAAGGG + Intergenic
1000731441 5:164838797-164838819 ATAGGAAGGAGGAATGAAGAGGG - Intergenic
1000814297 5:165900932-165900954 AAAAAGAAAGGGAATGAAGATGG - Intergenic
1001736104 5:174003639-174003661 ACAGAGGAGAGGACTGAGTACGG + Intronic
1001813040 5:174644974-174644996 ACAGAGAAAAGAAAGGAACATGG + Intergenic
1001981106 5:176037532-176037554 ACAGGATAGAGGAAAGAAGAGGG + Intergenic
1002193703 5:177491469-177491491 ACACAGGAGAGGAAGAAAGACGG + Intronic
1002236354 5:177806534-177806556 ACAGGATAGAGGAAAGAAGAGGG - Intergenic
1002352691 5:178594233-178594255 ACAGAGGAGAGGACAGGAGAGGG + Intergenic
1002781144 6:367228-367250 ACAAAGAAGAGGGTTGAGGAGGG - Intergenic
1003426197 6:5999811-5999833 ACAGAAGAGAGGAAAGCAGACGG - Intronic
1003541769 6:7024430-7024452 ACAGAGAAGGGGCAACAAGATGG + Intergenic
1003542269 6:7027974-7027996 ACAGAGAAGCGGATAGAAGTAGG + Intergenic
1003672712 6:8174368-8174390 AGAGAGATGAGGAATGCAGTGGG + Intergenic
1004028012 6:11837636-11837658 CCAGAGAGGAGGAATCTAGAGGG - Intergenic
1004366722 6:15019219-15019241 AGAGAGAATAGGAAAGAAGGGGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1005066303 6:21821052-21821074 GCAGAGAAAAGGAATGGAGCCGG - Intergenic
1005195308 6:23276286-23276308 TCAGAGAGGTTGAATGAAGAAGG - Intergenic
1005287680 6:24346273-24346295 ACAGAAAAGAGACAGGAAGAGGG + Intronic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005893759 6:30161064-30161086 GCAGAGGAGAGGAAGGAAGAGGG + Intergenic
1006262053 6:32883143-32883165 AGAGAGAACAGGAAAGAAGATGG + Intergenic
1006684744 6:35823282-35823304 ACAGAGGAGAGGCTTCAAGAAGG - Exonic
1007364007 6:41377396-41377418 AGAAAGAAGAGAAAAGAAGAAGG + Intergenic
1007464851 6:42044452-42044474 ACATAGAAGAGGAAAGCAGGGGG + Intronic
1007577167 6:42932654-42932676 ACAGAGTACAGGACAGAAGAGGG + Intronic
1007806989 6:44457840-44457862 AGAAAGCAGAGGAATGGAGAAGG + Intergenic
1007919367 6:45592481-45592503 ACAGAGAAGAGGAAGAAATAGGG + Intronic
1008840192 6:55893544-55893566 ACAGAGAAGAGTATTCCAGATGG - Intergenic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1009310288 6:62142115-62142137 AGAGAGAAGAGTACTGATGAGGG + Intronic
1009339570 6:62537085-62537107 ATAAAGAAGAGGAAGTAAGAAGG - Intergenic
1009676722 6:66833680-66833702 ACAGAGAAGAGAAATAAAAGTGG - Intergenic
1009773755 6:68178326-68178348 TGAGAGAAGAGGAGTGAAAAAGG - Intergenic
1010413471 6:75587266-75587288 AAAGAGAAGAGAAAAGAAAAAGG - Intergenic
1010696949 6:78987617-78987639 GAAGAAAAGAGGAATGGAGATGG + Intronic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1010756629 6:79672849-79672871 AAAGATCAGAGGAATGAAAAGGG + Intronic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011309306 6:85964441-85964463 GCAGAGAAGGGGACTGGAGAGGG + Intergenic
1011766287 6:90623549-90623571 CCAGAGAGGAGGAATCTAGAGGG - Intergenic
1011770422 6:90669747-90669769 ACAGAGAAGAGAAAGAATGAAGG - Intergenic
1011892820 6:92188364-92188386 ACAGAGAGGAGGTATAGAGAGGG + Intergenic
1011960863 6:93088358-93088380 ACAGAGAAGAGATAAGAATAAGG + Intergenic
1012427517 6:99130771-99130793 AAAGAGAAGAGGGAGGGAGAAGG - Intergenic
1012644384 6:101661172-101661194 TCAGAGAGGAGGAATCTAGAGGG + Intronic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013286001 6:108682346-108682368 ACAGATCAGGAGAATGAAGAGGG + Exonic
1013452468 6:110297996-110298018 GCAGAGAAAAGGGAGGAAGAGGG + Intronic
1013815267 6:114090437-114090459 ACAGAGAAGAGGGAGGAGGGAGG - Intronic
1013827603 6:114232781-114232803 ACAGAGAAAAGTAGTGAAGTAGG - Intronic
1013834313 6:114314882-114314904 ACTGTGAAGAGGAATGAATAAGG + Intronic
1013899642 6:115139274-115139296 ACAGAGAAGAAGGATAAAGAGGG + Intergenic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014149960 6:118043378-118043400 ACAGAGAAGAGTTTTGAATAAGG + Intronic
1014699181 6:124662179-124662201 ACAGGTGAGGGGAATGAAGAGGG + Intronic
1014992282 6:128095628-128095650 ACTAAGCAGAGGAATTAAGAAGG + Intronic
1015036325 6:128659386-128659408 ATATAGAAGAGGAAGGCAGAAGG + Intergenic
1015170162 6:130243285-130243307 TCAGAGAAGAGGAAGGGAGCAGG - Intronic
1015288942 6:131516059-131516081 ACACAGAAGAAGATTGAAGTTGG - Intergenic
1015334103 6:132016123-132016145 ACAAATAAAAAGAATGAAGAGGG - Intergenic
1015492360 6:133839967-133839989 ACACAGAAGTAGAAGGAAGAAGG - Intergenic
1015619717 6:135118431-135118453 AGAGAGAAGAGGAGTGAGGCAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015678366 6:135776605-135776627 ACAGAGAAGAGGAAATATTAAGG + Intergenic
1016023373 6:139259094-139259116 GCAGAGAAGAGGGGTGGAGATGG - Intronic
1016631872 6:146242292-146242314 ACAGAGCTGAGTATTGAAGAGGG - Intronic
1016640152 6:146338877-146338899 ACAGAGTAGAGAAGAGAAGAAGG - Intronic
1016671059 6:146708884-146708906 AAAAAGAAAAGGAATGAAAAAGG - Intronic
1016701157 6:147055825-147055847 ACAGAGAAGAGAAAGGAGGTAGG - Intergenic
1016805620 6:148209437-148209459 ACAGAGAAGAGAAATTCATAGGG + Intergenic
1016900084 6:149092563-149092585 AGAGGGCAGATGAATGAAGAGGG - Intergenic
1017447191 6:154517738-154517760 AAAGAGAAAAGAAAAGAAGAGGG + Intergenic
1017651973 6:156591952-156591974 ATAAAGAATAGGAATGAAGTGGG + Intergenic
1017731175 6:157317494-157317516 AAAGAGAAGAGGTCTGAGGAAGG - Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018181463 6:161226931-161226953 GCAGGGAAGAAGAAGGAAGAAGG + Intronic
1018185348 6:161261751-161261773 AAAGAGAAAAGGAATAAAGAGGG - Intronic
1018284149 6:162218833-162218855 ACAGAAAAGAAGTAAGAAGATGG - Intronic
1018366727 6:163128479-163128501 ACAGACAAGAGAAATGACAAAGG - Intronic
1018607541 6:165613926-165613948 AGCGAGAAGGGGAATGGAGAAGG - Intronic
1018868450 6:167763287-167763309 CCAGAGAAGAGGGAAGGAGAAGG - Intergenic
1019046855 6:169156099-169156121 ACAGAGAAGAGGAGTAAATCCGG + Intergenic
1019273955 7:166219-166241 ACAGAGAATAGGAAGGAGGAAGG - Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019841509 7:3450808-3450830 AGAGAGAAGAGGGATGAAGATGG + Intronic
1020758307 7:12234388-12234410 AGATAGAAGAGAAATAAAGATGG + Exonic
1021258221 7:18421342-18421364 ACAGAAAAAAGGAAGGAAGGGGG + Intronic
1021336874 7:19414100-19414122 ACAATGAAAAGGAATAAAGATGG + Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021768408 7:23972116-23972138 TCAGAGAAAAAGAATGAACAGGG - Intergenic
1021806188 7:24358347-24358369 AGAAAGAAGAGGAAGAAAGAAGG + Intergenic
1021956751 7:25832962-25832984 AAAGAGAAGAGAAATTAAGAAGG - Intergenic
1022165107 7:27751728-27751750 TAAGGGAGGAGGAATGAAGATGG + Intronic
1022218189 7:28286108-28286130 AGAGAGTGGAGGAAGGAAGAAGG + Intergenic
1022355973 7:29614861-29614883 AAAGAGAAAAGGAAAGAAGCAGG + Intergenic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022585954 7:31611941-31611963 AAAGAGAAGAGAAAAGAAAAAGG - Intronic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023043346 7:36191620-36191642 ACACAGAAGAAGAGAGAAGAAGG + Intronic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023740552 7:43277448-43277470 GCAGATAAGAGGGATGAGGAAGG + Intronic
1023873481 7:44274958-44274980 ACAGAAAAGAGGAGTGAGGCAGG + Intronic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024377252 7:48653942-48653964 ACAGAGAAGAGAGGTGATGATGG + Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025042996 7:55664010-55664032 TCAGTGTAAAGGAATGAAGAAGG + Intergenic
1025124550 7:56334363-56334385 ACAGAGTACAGGAATGCACAAGG - Intergenic
1025135919 7:56412544-56412566 TCAGTGTAAAGGAATGAAGAAGG + Intergenic
1025289447 7:57701602-57701624 CCAGAGAAGAGAAATCAAAATGG + Intergenic
1025480963 7:60982075-60982097 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025488071 7:61076955-61076977 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025556734 7:62318871-62318893 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025565902 7:62433517-62433539 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025837966 7:65113337-65113359 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025879303 7:65519741-65519763 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025879309 7:65519774-65519796 AAAGAAAAAAGGAAGGAAGAAGG - Intergenic
1025885103 7:65582634-65582656 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025885109 7:65582667-65582689 AAAGAAAAAAGGAAGGAAGAAGG - Intergenic
1025986129 7:66453786-66453808 AAAGAGAGGAGGAAGGAAGAAGG + Intergenic
1026002974 7:66577090-66577112 AAAGAGGGGAGGAAGGAAGAAGG + Intergenic
1026183828 7:68065524-68065546 CAAGAGAAGAGGAAAGAAGAAGG + Intergenic
1026381421 7:69803453-69803475 ACAGAGGAGAGAAACCAAGATGG - Intronic
1026537224 7:71248917-71248939 GTAGAGAAGAGGCAAGAAGATGG - Intronic
1026775236 7:73227097-73227119 AAAGAAAAGAAGAAAGAAGATGG + Intergenic
1027016093 7:74780468-74780490 AAAGAAAAGAAGAAAGAAGATGG + Intronic
1027071935 7:75165469-75165491 AAAGAAAAGAAGAAAGAAGATGG - Intergenic
1027209350 7:76132333-76132355 AAAGAGGGGAGGAAGGAAGAAGG + Intergenic
1027693333 7:81375642-81375664 ACAGACAAGAGAAAGGAATAAGG - Intergenic
1027917498 7:84344368-84344390 TCAGAGAAGAGCAATTAATAAGG + Intronic
1028101215 7:86823335-86823357 ACAGAGAAGAGGAAAAAAAAAGG - Intronic
1028968143 7:96826156-96826178 AGTGAGATGGGGAATGAAGAGGG + Intergenic
1029165304 7:98585031-98585053 GGAGAGAAGAGGAAGGAAGGAGG - Intergenic
1029462116 7:100701243-100701265 ACAGAAAAAAGGAAGGAAGGAGG - Intergenic
1029552919 7:101247529-101247551 ACTGAAAACAGGACTGAAGACGG + Intronic
1030473003 7:109991506-109991528 AGAGAGGAGAGGAATGCAGGGGG - Intergenic
1030868500 7:114728853-114728875 AAAAAAAAGAGGAAGGAAGAAGG - Intergenic
1031116236 7:117671969-117671991 ACAGAAAACAGGAATAAATATGG - Intronic
1031691210 7:124790128-124790150 AAAGAGAAGAGGGATAAAGTGGG - Intronic
1031748064 7:125530486-125530508 GGAGAGAAGAGGACAGAAGAAGG + Intergenic
1032183510 7:129702703-129702725 ACAGAAAACAGGAATGTAGCAGG - Intronic
1032261690 7:130343123-130343145 AAAGAAAAGAAGAAAGAAGAAGG - Intergenic
1032735685 7:134690848-134690870 GCAGAAAAAAGGAATGAAGTCGG - Intergenic
1033230213 7:139591481-139591503 ACAGGGAAGAAGGAGGAAGAGGG - Intronic
1033420303 7:141199565-141199587 AGAGAGAAGAGGAAGGAAAAAGG - Intronic
1033487001 7:141800633-141800655 CCAGAGAATAGGAATAAAAAGGG + Intergenic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1033642272 7:143272889-143272911 ACAAAAAAAAGGAAAGAAGAAGG + Intergenic
1033678439 7:143568263-143568285 ACAAAGAAAAGAAAGGAAGAAGG - Intergenic
1033693402 7:143761186-143761208 ACAAAGAAAAGAAAGGAAGAAGG + Intergenic
1033843858 7:145407877-145407899 AAAGAGAAGAGAGATGAAGCTGG - Intergenic
1033907360 7:146222007-146222029 AAAGAGAAAAGGAAGGAAGAAGG + Intronic
1034066183 7:148139006-148139028 ACAGAGAAAAGGAAGCAAAAGGG - Intronic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034463186 7:151209807-151209829 ACCGAGAAGAGGAGTGATCAGGG - Intronic
1034865084 7:154634703-154634725 AAAGAGAAGAAGGAAGAAGAAGG - Intronic
1035936092 8:3841483-3841505 TCATAGAAGAGCAATGAAAAGGG - Intronic
1036996345 8:13661616-13661638 ACAAGGAAAGGGAATGAAGATGG - Intergenic
1037094939 8:14974829-14974851 AAACATAAGACGAATGAAGAGGG + Intronic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037458571 8:19086353-19086375 AGAGAGAAAAGGAAGAAAGAAGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037891367 8:22625434-22625456 CCAGAGAGGAGGAAAGACGAGGG + Intronic
1038151720 8:24947361-24947383 ACAGAATAAATGAATGAAGAAGG - Intergenic
1038260405 8:25988137-25988159 AGATAGAAGAGAAATAAAGAGGG + Intronic
1038298900 8:26323838-26323860 ACAGAGAAGTGGAAGGGAGTGGG - Intronic
1038457820 8:27689366-27689388 ACAAGGAAGAGGAACGAGGAAGG + Intergenic
1038531056 8:28318139-28318161 AAAGAGAGGAGGAAGAAAGAAGG - Intronic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039153616 8:34530741-34530763 ACAGAAAAGAGGAAATAGGAAGG + Intergenic
1039289872 8:36082871-36082893 ACAGACAAGAGGGAAGGAGAAGG + Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039623859 8:39027352-39027374 ACAGAGAAGAGGAGAGAGAATGG + Intronic
1039744224 8:40409358-40409380 ACAGAGCAAAGCAATGAAGAAGG + Intergenic
1039792854 8:40889187-40889209 GCAGCGAAGAGGAAGGAACAAGG + Intronic
1040033331 8:42845414-42845436 ACAGTGAGGAGACATGAAGAGGG - Intergenic
1040592885 8:48811418-48811440 AAAGAGAAGAGAAAAGAAGAAGG + Intergenic
1040918545 8:52589811-52589833 AGAGAGAAGAGAGATGGAGAAGG - Intergenic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041139202 8:54796848-54796870 ACAGAAATGAGGAACGAAAATGG + Intergenic
1041347140 8:56911101-56911123 ACAGAGAAGATGGATGAGGGAGG + Intergenic
1041538539 8:58956057-58956079 ACACAGAAGAGGAAAGAATGGGG + Intronic
1041647416 8:60267577-60267599 GCAGAAAAGCGGGATGAAGAGGG + Intronic
1041827115 8:62108629-62108651 AGAGAGGAGAGGAAGGAAGTCGG + Intergenic
1042481755 8:69312399-69312421 ACAGTGTAGTGGAAAGAAGATGG - Intergenic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042716463 8:71778502-71778524 ACAAAAGAGAGGAATGAGGAAGG + Intergenic
1042926556 8:73973403-73973425 AAAGAGAAGAGAAAAGAAAAGGG - Intronic
1043041343 8:75265760-75265782 AGAGAGATAAGAAATGAAGATGG - Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043469697 8:80550139-80550161 ACAGAAAAATGGAATGAAAAAGG - Intergenic
1043574530 8:81642758-81642780 AAAGAGAAGAGAGAAGAAGAGGG + Intergenic
1044054481 8:87551601-87551623 AAAGAAAAGAGGAAAGAAGAAGG + Intronic
1044068620 8:87727544-87727566 AGAGAGAAGAAGAATGAAGGAGG - Intergenic
1044323993 8:90839598-90839620 ACTAAGAAGAGGTATGAATAAGG + Intronic
1044356710 8:91230815-91230837 ACACGGAAGATGAATTAAGAGGG + Intronic
1044423068 8:92021219-92021241 ACAGGAAACAGGAAAGAAGAAGG + Intronic
1044560001 8:93603482-93603504 CCATAGAAGAGGCATGAAGGGGG + Intergenic
1044755175 8:95454101-95454123 AGAGAGAAGAGGAATGGTAAAGG - Intergenic
1044760941 8:95516802-95516824 ACAGAGAAGAGCAACGGACAAGG - Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045244280 8:100429386-100429408 ACAGAGCAGAGGCATGAGGTTGG + Intergenic
1045364125 8:101459914-101459936 TCAGAGCAGAGGAATGAAGTGGG + Intergenic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1046064403 8:109179587-109179609 AGAGAGGAGAAAAATGAAGATGG - Intergenic
1046445216 8:114310743-114310765 AAAGAGAAGAGGAAGAAAGGAGG - Intergenic
1046629937 8:116613344-116613366 ACACAGAAGGGGAATGAATCAGG + Intergenic
1046936489 8:119889685-119889707 ACAGGGGAGAGGAGTGGAGAAGG + Intronic
1047363472 8:124190965-124190987 AGAGAGAAGAAGAAAAAAGAAGG + Intergenic
1047906505 8:129478859-129478881 ACAGAGAAGTTGGATGAAGTTGG + Intergenic
1047921461 8:129638956-129638978 AAAGATAACAGGAATGGAGAAGG + Intergenic
1048005753 8:130418083-130418105 AGAGAGGAGAGGAAAGGAGATGG + Intronic
1048008579 8:130438759-130438781 ACAGAGAAGAGCTCTGACGAAGG + Intronic
1048129900 8:131684187-131684209 ACAGAGAAGAGGACAGAATGTGG + Intergenic
1048161871 8:132028777-132028799 AAAGAGAGGAAGAAAGAAGAAGG + Intronic
1048739771 8:137542303-137542325 ACAGAAAAAAGGAATAAAAAAGG - Intergenic
1048742379 8:137575642-137575664 ACAGAGGAAAGGAAAGAAAATGG - Intergenic
1048870137 8:138790525-138790547 AGCGGGAGGAGGAATGAAGAGGG - Intronic
1049415980 8:142495368-142495390 ACTGAGAGAAGGAAAGAAGATGG + Intronic
1050306216 9:4308355-4308377 ACAGAGGGAAGGAATGAAGGAGG + Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051073762 9:13205991-13206013 AATGAGGAGAGGAATGAAGCAGG - Exonic
1051256554 9:15219685-15219707 TCTCAGAGGAGGAATGAAGAGGG - Intronic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1051693869 9:19747212-19747234 AGAGAGAAGTGGAATGAAGAGGG - Intronic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1051844990 9:21441861-21441883 ACAGAGAAAAGGACTTAAGCAGG + Intergenic
1052104146 9:24491382-24491404 ACAGAGGAGAAGAATTGAGAAGG - Intergenic
1052144937 9:25037042-25037064 ACAGAGGAGAGTTCTGAAGATGG - Intergenic
1052152850 9:25140452-25140474 ACTGAGAAGGGGAGGGAAGAGGG + Intergenic
1052180387 9:25519057-25519079 ACAAAGAATAGAAATAAAGAAGG - Intergenic
1052366164 9:27614631-27614653 CCAGAGAGGAGGAATCCAGAGGG + Intergenic
1052392960 9:27902558-27902580 AAAGAGAAGAGTAATAAAGAGGG - Intergenic
1052412644 9:28142081-28142103 ACACAGAAAAGGAAGGAAGTTGG - Intronic
1052642868 9:31192061-31192083 ACAGGGAGGAGGAAAGAAGGTGG - Intergenic
1053425477 9:38007330-38007352 GCCCAGAAGAGAAATGAAGATGG + Intronic
1053565401 9:39244490-39244512 ATAGGGAAGAGGAGTGAAGCTGG + Intronic
1053608688 9:39687278-39687300 GCAGAAAAGAGGAAGGAGGAAGG - Intergenic
1053831169 9:42082337-42082359 ATAGGGAAGAGGAGTGAAGCTGG + Intronic
1054131749 9:61374549-61374571 ATAGGGAAGAGGAGTGAAGCTGG - Intergenic
1054244836 9:62655132-62655154 GCAGAAAAGAGGAAGGAGGAAGG + Intergenic
1054558962 9:66689663-66689685 GCAGAAAAGAGGAAGGAGGAAGG + Intergenic
1054599378 9:67105101-67105123 ATAGGGAAGAGGAGTGAAGCTGG - Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055568035 9:77588610-77588632 ACAGAGAGGAGCAAGGAAGCAGG + Intronic
1055624293 9:78158750-78158772 AAAAAGAAGAGGAATGGAAAAGG - Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1055767765 9:79683223-79683245 AAGGAGAATAGGAATGGAGAAGG - Intronic
1056307186 9:85301657-85301679 AAAGAGAAGAGGAAAGAATTAGG + Intergenic
1056785595 9:89590637-89590659 GCAGAGAAAAGAAATAAAGAAGG - Intergenic
1057075711 9:92137166-92137188 ACAGAGCAGAGGACAGAGGAAGG + Intergenic
1057815372 9:98290347-98290369 ACAAAGAAGAGGAACGGAAATGG - Exonic
1057875884 9:98754253-98754275 CCAGAGAGGAGGAATGCAGATGG + Intronic
1057940858 9:99282277-99282299 AAAGAAAAGAGAAAAGAAGAGGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058232196 9:102440575-102440597 ACAGAGAAGAGAAATGGAGGAGG + Intergenic
1058237938 9:102516731-102516753 ACATACATGTGGAATGAAGAGGG + Intergenic
1058357726 9:104104029-104104051 ACAGAAAAGAAGGATGAAAAAGG - Intronic
1058362747 9:104169495-104169517 ACAGGAAAGAGGAAAGAACATGG - Intergenic
1058466838 9:105237393-105237415 ACAGATAAGAGAAATTCAGAGGG - Intergenic
1058577443 9:106419084-106419106 ACAGTGTAGAGGAAAGAACATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059374145 9:113869241-113869263 AAAAAGAAAAGGAATAAAGATGG - Intergenic
1059656075 9:116358714-116358736 GAAGAGAAGAGGAAGGAAGAGGG - Intronic
1059713289 9:116889224-116889246 AAAAAGAAGAGGAAAAAAGAAGG + Intronic
1059950333 9:119455568-119455590 ACAGAGAAGGGAAAGAAAGAAGG - Intergenic
1060268021 9:122123425-122123447 ACGGAGATGAGGACTGAAGAGGG - Intergenic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060313997 9:122491433-122491455 GGAGAGAAGAGGAAAGGAGAAGG + Intergenic
1061067067 9:128285193-128285215 AGAGAGGAGAGGAAAGAAAAAGG + Intronic
1061246037 9:129401708-129401730 ACAGGGAGGAGGGAGGAAGAAGG - Intergenic
1061572502 9:131486362-131486384 ACAGGGAAGAGGAGTGGAGTTGG + Intronic
1061619185 9:131800089-131800111 CCAGACAAGAGGAATGAGGGTGG - Intergenic
1061751607 9:132781936-132781958 ACAGAGATGAGAAAGGAGGAAGG + Intronic
1062543723 9:137052754-137052776 AGACAGAGGAGGAAGGAAGAGGG - Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1203615812 Un_KI270749v1:62495-62517 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185619531 X:1444982-1445004 AGAGAGAAGAGGGAAGAAGACGG - Intronic
1185772188 X:2773265-2773287 ACTGAGGGGAGGAAGGAAGAAGG + Intronic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1185820250 X:3196094-3196116 AGAGAGAAGGGAAAGGAAGAAGG + Intergenic
1185861260 X:3581705-3581727 AGAAAGAAGGGGAATGATGAAGG + Intergenic
1185967006 X:4617532-4617554 ACAAAGAAGAGGGCAGAAGAAGG + Intergenic
1186092189 X:6061923-6061945 ACAGAGAAGAGAAAGGACCAAGG - Intronic
1186181743 X:6980189-6980211 AAAGAGAAGAGAAGAGAAGAAGG - Intergenic
1186363026 X:8862580-8862602 AGAGAGAAGAGGAGAGAAGAAGG + Intergenic
1186643719 X:11483955-11483977 ACAGATAAGAGAGTTGAAGACGG - Intronic
1187500384 X:19833764-19833786 AGAGTGAAGATGAAGGAAGAAGG - Intronic
1187545941 X:20252662-20252684 ACAGGGAGGAGGAAAGCAGAGGG + Intronic
1187553108 X:20325774-20325796 ACGGAGAACAGGAAGGGAGAAGG + Intergenic
1187944388 X:24412146-24412168 AAAGAGCAGGGGAATGAAGAAGG - Intergenic
1188392156 X:29634046-29634068 ACAGACAAGAAGATTTAAGAAGG + Intronic
1188472263 X:30553949-30553971 AAAAAGAAGAGGAAGGGAGAAGG + Intergenic
1188735570 X:33710407-33710429 AGAGAGAAGAGGAAAGAAGTAGG + Intergenic
1188962902 X:36514744-36514766 ACAGGTAAGAGCAATGAAAAAGG + Intergenic
1189327132 X:40119645-40119667 AAAAAGAAGAGGAGTCAAGATGG + Intronic
1189908940 X:45790242-45790264 ACAGAGAAAAGGAAAAAACAGGG - Intergenic
1190027397 X:46937643-46937665 AGATAGAAGAGGGATGCAGAGGG - Intronic
1190072879 X:47293264-47293286 AGAGAGAAGAAGGAGGAAGAAGG + Intergenic
1190338783 X:49280016-49280038 GCAGTCAAGAGGAATGAGGATGG - Intronic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190828465 X:54040028-54040050 ACACAGAAAAAGAATAAAGAAGG - Intronic
1190943809 X:55071736-55071758 AGAGAGAAAAGAAATGAACAAGG - Intergenic
1191100350 X:56719729-56719751 ACAGCTAAGAGAACTGAAGATGG + Intergenic
1191793800 X:64999883-64999905 CCAGAGAGGAGGAATCTAGAGGG - Intronic
1191834228 X:65446714-65446736 ACACTGCAGAGGAATGCAGAAGG + Intronic
1192211462 X:69130495-69130517 AAAGAGAGGAGGAAAGAAGAGGG + Intergenic
1192315477 X:70048070-70048092 GCAGAGAAGAGGAAAGAAGAGGG - Intronic
1192362724 X:70449612-70449634 ACAGAGAAGTGGGAGGAAGCAGG + Intronic
1192511160 X:71721109-71721131 AGAGAGAATAGCACTGAAGAAGG - Intergenic
1192515537 X:71760444-71760466 AGAGAGAATAGCACTGAAGAAGG + Intergenic
1192593147 X:72378607-72378629 ACAAAGGAGAGGCATGAAAATGG - Intronic
1193894158 X:87090796-87090818 ACAGACAAGAGAAATAAATAAGG + Intergenic
1193925274 X:87476592-87476614 GCAGAGAAGAGGGAAGAGGAGGG - Intergenic
1193952722 X:87821104-87821126 ACAGAAAACAGAAATGAAAATGG - Intergenic
1195081371 X:101374616-101374638 TCAGAGAAGAGGCAGTAAGAAGG - Exonic
1195140130 X:101950622-101950644 CCAGTGAAGAGGAATCTAGAGGG - Intergenic
1195192269 X:102460764-102460786 AATGACAAGAGGAACGAAGACGG + Intronic
1195316962 X:103688352-103688374 AAAGAAAAGAGGGATGGAGAGGG - Intergenic
1195649040 X:107265277-107265299 AAAGAGAAAAGAAATGAACACGG + Intergenic
1195676423 X:107510629-107510651 TCAGAAAAGGGGAATGAAGTTGG - Intergenic
1196016901 X:110949278-110949300 ACACTCAAGAGGAATGAGGAGGG - Intronic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197859658 X:130956800-130956822 TGAGAGAAAATGAATGAAGAGGG + Intergenic
1198063341 X:133070038-133070060 AGAGACAAGAGGAAAGATGAGGG + Intronic
1198506365 X:137305008-137305030 GCAGAGAAGAGGACTGAGAAAGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199471799 X:148203973-148203995 AGAGAGAAGAGGGAAGGAGAAGG + Intergenic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1199839979 X:151636060-151636082 ACAGAGAAGGGGCACAAAGAAGG - Intronic
1199935315 X:152567753-152567775 TTAGAGAAGAGGAATGACAAGGG + Intergenic
1200281951 X:154784611-154784633 TCAGAAAAGAGAAATGCAGATGG + Intronic
1200314365 X:155116196-155116218 GTAGAGAAGAGGAGTGAAGAGGG - Intronic
1200517700 Y:4166663-4166685 ACAGAGGAGAGGAAGGGAGTGGG + Intergenic
1200840641 Y:7777624-7777646 AAAGAAAACAGAAATGAAGAAGG + Intergenic
1201256680 Y:12114359-12114381 ACAGAGGAGAGGAATGGTGATGG - Intergenic
1201490906 Y:14540267-14540289 CCAGAGAAGAAGAATCTAGAGGG - Intronic
1201922728 Y:19252287-19252309 ACAGAGAAGGGGAGATAAGAAGG + Intergenic
1202189981 Y:22231647-22231669 AGAGAGAAGATGGAGGAAGAAGG + Intergenic