ID: 970203045

View in Genome Browser
Species Human (GRCh38)
Location 4:13628239-13628261
Sequence CCGTGGGGGTCCCTTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970203034_970203045 20 Left 970203034 4:13628196-13628218 CCAAGTTCCTTCTGTCTCTCTTC 0: 1
1: 0
2: 5
3: 90
4: 798
Right 970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
970203035_970203045 13 Left 970203035 4:13628203-13628225 CCTTCTGTCTCTCTTCTGCCTGC No data
Right 970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
970203036_970203045 -5 Left 970203036 4:13628221-13628243 CCTGCACATACCATTTCCCCGTG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970203045 Original CRISPR CCGTGGGGGTCCCTTGTTTC TGG Intergenic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902601064 1:17540320-17540342 CCTTGGGGGTCCCTGGGATCGGG + Intronic
906880518 1:49584176-49584198 GAGAGGGGGTCCCTAGTTTCTGG - Intronic
907508515 1:54940790-54940812 TCTTGTGGGTCCCATGTTTCAGG + Intergenic
919735495 1:200947732-200947754 CCCTGTGGGTCCCTTCTCTCTGG - Intergenic
920398016 1:205660508-205660530 CCGTGGGCTTCCCTGGTGTCAGG - Intronic
1070669281 10:78366792-78366814 CAGTGGGGGTCCAGTGCTTCTGG - Intergenic
1070787401 10:79169947-79169969 ACCTGGGGGTCCATTGTCTCTGG - Intronic
1077865036 11:6214980-6215002 TGGTGGGGGTCTCTTGTTTTGGG - Intronic
1079083187 11:17428133-17428155 ACTTGGTGGTCCCTGGTTTCTGG + Intronic
1083603178 11:63961478-63961500 CCATGGGCCTCTCTTGTTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1089723185 11:120449164-120449186 CCGTGGGGGTCCCAGGATGCTGG - Exonic
1089876297 11:121724932-121724954 CCCTGGGGATCCCTTATTACCGG + Intergenic
1091237525 11:134032031-134032053 CCTTGGGGCTGCCTTGTTTCAGG + Intergenic
1095163334 12:38941880-38941902 CCTTGGGGGTCCCTGATTCCAGG + Intergenic
1096524259 12:52201206-52201228 CCGTGGGGGTTCCCTGGATCTGG - Intergenic
1105243745 13:18629095-18629117 CTGTGGGGGTCCATCGTTGCCGG + Intergenic
1108094016 13:46881267-46881289 CCCTGCGGATCCTTTGTTTCAGG + Intronic
1110247938 13:73348133-73348155 CCGTGCAGCTCCCTTGTCTCTGG - Intergenic
1120513506 14:85443375-85443397 CTGTGGTGGTCCCTTTCTTCTGG + Intergenic
1128881033 15:71242971-71242993 CCGTGGTTGTTGCTTGTTTCTGG - Exonic
1132885537 16:2180527-2180549 CGGCGGGGGCCCCTTCTTTCGGG + Exonic
1133614764 16:7465675-7465697 CCCTGGGGATCCTTTGCTTCTGG + Intronic
1138430029 16:56962749-56962771 TCGTGGGGTTCCCATGTGTCAGG + Intronic
1142894738 17:2966581-2966603 AGGTGGGGGTCCGTGGTTTCAGG + Intronic
1145322087 17:21772662-21772684 CCTTGAGGGACCCTTGTCTCTGG - Intergenic
1147157879 17:38553516-38553538 CCGGGGAGGTCTCTTGTCTCGGG + Intronic
1147427182 17:40351487-40351509 CCCTGGGGGTCCCTTGGGACTGG - Intronic
1152299622 17:79487412-79487434 CTGTGCGTGTCCCTTGCTTCTGG - Intronic
1154445197 18:14430790-14430812 CTGTGGGGGTCCATTGTTGCCGG - Intergenic
1160557648 18:79736438-79736460 CCCTGCGGGTCCCTGGCTTCCGG - Exonic
1161178152 19:2860268-2860290 CAGTGGTGGTCCCTGTTTTCAGG + Exonic
1162792194 19:13068950-13068972 CATTCGGGGTCCCTGGTTTCTGG - Intronic
1167520469 19:49951680-49951702 GCCTGGGGGGCCCTTGGTTCTGG + Intronic
1167578901 19:50330798-50330820 CCGAGGCGGTCCCCTTTTTCTGG - Intronic
927133091 2:20077048-20077070 CCGTGGGGGGCTCATGTTTCAGG - Intergenic
936053001 2:109239767-109239789 CTGTGGGAGTCCCTTGTCTTTGG + Intronic
937657784 2:124396461-124396483 TCTAGGGGGTCCCTTTTTTCTGG + Intronic
938373437 2:130788437-130788459 CGGTGGGGGGCACTAGTTTCAGG + Intergenic
941678621 2:168371290-168371312 CCTTGGGGGTCCCCAGTTCCAGG + Intergenic
946117309 2:217474571-217474593 CCATGGAGGGTCCTTGTTTCTGG + Intronic
1169961673 20:11167401-11167423 GTGTGGGGGGCCCTTGTTCCAGG - Intergenic
1171486725 20:25491025-25491047 CCATGGGTGTTCCTGGTTTCTGG + Intronic
1173167115 20:40693064-40693086 AGGTGGGGGTCCCCTGATTCAGG - Intergenic
1175753403 20:61514468-61514490 CCTTGGGGGGCTCTTGTTTTAGG + Intronic
1176035531 20:63034608-63034630 CGCTGCGCGTCCCTTGTTTCCGG - Intergenic
1185417848 22:50720020-50720042 CCGCGGGCGTCCATTGTGTCCGG + Intergenic
949967534 3:9370949-9370971 CCGTGGGGGACACTGGTTCCAGG - Intronic
958491297 3:94777257-94777279 CTGTGGGGCTCCCTTAGTTCTGG - Intergenic
960404159 3:117238891-117238913 TCTTGGGGGTCCCTGATTTCAGG + Intergenic
969683086 4:8653866-8653888 CCCTGGGCGTTCCTTGGTTCGGG + Intergenic
970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG + Intergenic
970551870 4:17189673-17189695 CCATGGGGGTTCCATCTTTCAGG + Intergenic
972136885 4:35903819-35903841 CTGTGGGGGTCCCATGTTGCTGG - Intergenic
976246680 4:83012417-83012439 CCGTGGCGGCCCCAGGTTTCTGG - Intronic
982108178 4:152029425-152029447 CCCTTGGGATCCCCTGTTTCAGG - Intergenic
1001587835 5:172845267-172845289 CCTTGGGGGGCCCTGGTTGCTGG + Intronic
1002262066 5:178000219-178000241 CTGTGGGTTTGCCTTGTTTCTGG - Intergenic
1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG + Intronic
1016989859 6:149921712-149921734 GAGTGGGGGTCCCATGGTTCAGG - Intronic
1019414408 7:920693-920715 CCGTGGGGGGCCCTCGTCCCGGG - Intronic
1027151710 7:75738445-75738467 CCGTGCGCTTCCCTTGTTTAGGG + Intronic
1041954408 8:63541757-63541779 CCCTGGGTTTCACTTGTTTCTGG - Intergenic
1057521638 9:95765008-95765030 TCTTGGGGGATCCTTGTTTCTGG - Intergenic
1061651685 9:132055272-132055294 CTGCTTGGGTCCCTTGTTTCAGG - Intronic
1062669304 9:137697352-137697374 CTGTGGGGGTCTCTGGTTCCAGG + Intronic
1185466322 X:356813-356835 CCGTGGGGCTCCCGTGTGGCTGG - Intronic
1186971412 X:14848896-14848918 CCGGGGGGGTCACTGCTTTCTGG - Intronic
1189337599 X:40179722-40179744 TCTTGGGGGCCCCTTGTATCCGG - Intergenic
1192598304 X:72435199-72435221 CAGTGTGGTTCCCTTCTTTCAGG - Intronic
1195364889 X:104116252-104116274 CCCTGAGGGTCCCAAGTTTCTGG + Intronic
1195926383 X:110029883-110029905 CAGTTAGGGTCCCTTGTTTCAGG + Intronic