ID: 970204802

View in Genome Browser
Species Human (GRCh38)
Location 4:13645176-13645198
Sequence CCTTCCAACCCTGTGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970204802_970204807 16 Left 970204802 4:13645176-13645198 CCAGAGAACACAGGGTTGGAAGG No data
Right 970204807 4:13645215-13645237 TCAGTGCAATTCCTCATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970204802 Original CRISPR CCTTCCAACCCTGTGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr