ID: 970207123

View in Genome Browser
Species Human (GRCh38)
Location 4:13666182-13666204
Sequence CAGGCTCATGACTCATGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970207123_970207127 10 Left 970207123 4:13666182-13666204 CCCTCTCATGAGTCATGAGCCTG No data
Right 970207127 4:13666215-13666237 CAGCTCCATCTTTCTAAATCTGG No data
970207123_970207128 11 Left 970207123 4:13666182-13666204 CCCTCTCATGAGTCATGAGCCTG No data
Right 970207128 4:13666216-13666238 AGCTCCATCTTTCTAAATCTGGG No data
970207123_970207130 17 Left 970207123 4:13666182-13666204 CCCTCTCATGAGTCATGAGCCTG No data
Right 970207130 4:13666222-13666244 ATCTTTCTAAATCTGGGTAGAGG No data
970207123_970207131 20 Left 970207123 4:13666182-13666204 CCCTCTCATGAGTCATGAGCCTG No data
Right 970207131 4:13666225-13666247 TTTCTAAATCTGGGTAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970207123 Original CRISPR CAGGCTCATGACTCATGAGA GGG (reversed) Intergenic
No off target data available for this crispr