ID: 970213634

View in Genome Browser
Species Human (GRCh38)
Location 4:13736237-13736259
Sequence AACATATTTCCCTCTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970213634_970213635 -5 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213635 4:13736255-13736277 ATGTTTTCTGAATAGAAGAAAGG No data
970213634_970213638 13 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213638 4:13736273-13736295 AAAGGGACTGGCTTGAGCGTTGG No data
970213634_970213637 1 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213637 4:13736261-13736283 TCTGAATAGAAGAAAGGGACTGG No data
970213634_970213641 30 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213641 4:13736290-13736312 CGTTGGATAGATCCAGGGACTGG No data
970213634_970213640 25 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213640 4:13736285-13736307 TTGAGCGTTGGATAGATCCAGGG No data
970213634_970213636 -4 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213636 4:13736256-13736278 TGTTTTCTGAATAGAAGAAAGGG No data
970213634_970213639 24 Left 970213634 4:13736237-13736259 CCTAGAGCAGAGGGAAATATGTT No data
Right 970213639 4:13736284-13736306 CTTGAGCGTTGGATAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970213634 Original CRISPR AACATATTTCCCTCTGCTCT AGG (reversed) Intergenic
No off target data available for this crispr