ID: 970218950

View in Genome Browser
Species Human (GRCh38)
Location 4:13787459-13787481
Sequence ATTTCTAGGCACCACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970218944_970218950 4 Left 970218944 4:13787432-13787454 CCACTGCGCCCAGCCAGGTTACA No data
Right 970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG No data
970218946_970218950 -5 Left 970218946 4:13787441-13787463 CCAGCCAGGTTACAGAATATTTC No data
Right 970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG No data
970218947_970218950 -9 Left 970218947 4:13787445-13787467 CCAGGTTACAGAATATTTCTAGG No data
Right 970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG No data
970218945_970218950 -4 Left 970218945 4:13787440-13787462 CCCAGCCAGGTTACAGAATATTT No data
Right 970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970218950 Original CRISPR ATTTCTAGGCACCACAGGCC TGG Intergenic
No off target data available for this crispr