ID: 970225096

View in Genome Browser
Species Human (GRCh38)
Location 4:13849539-13849561
Sequence ATGCAACTTAATAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970225094_970225096 -10 Left 970225094 4:13849526-13849548 CCCTGAGAAGTAAATGCAACTTA No data
Right 970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG No data
970225093_970225096 -9 Left 970225093 4:13849525-13849547 CCCCTGAGAAGTAAATGCAACTT No data
Right 970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG No data
970225092_970225096 -1 Left 970225092 4:13849517-13849539 CCTAGTTACCCCTGAGAAGTAAA No data
Right 970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970225096 Original CRISPR ATGCAACTTAATAAGCAAGA AGG Intergenic
No off target data available for this crispr