ID: 970225108

View in Genome Browser
Species Human (GRCh38)
Location 4:13849670-13849692
Sequence AAACCTGAACTGCTACCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970225104_970225108 30 Left 970225104 4:13849617-13849639 CCTATAGAAACCAAAGTTCACAT No data
Right 970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG No data
970225105_970225108 20 Left 970225105 4:13849627-13849649 CCAAAGTTCACATCTTAACATAT No data
Right 970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG No data
970225106_970225108 -5 Left 970225106 4:13849652-13849674 CCCTGAGTTGTTTTTTAAAAACC 0: 4
1: 5
2: 81
3: 145
4: 706
Right 970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG No data
970225107_970225108 -6 Left 970225107 4:13849653-13849675 CCTGAGTTGTTTTTTAAAAACCT No data
Right 970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970225108 Original CRISPR AAACCTGAACTGCTACCAAC CGG Intergenic
No off target data available for this crispr