ID: 970226271

View in Genome Browser
Species Human (GRCh38)
Location 4:13860514-13860536
Sequence AATCACACCCTGCTGCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970226268_970226271 11 Left 970226268 4:13860480-13860502 CCTTTATATTCTGCTAAACTTTT No data
Right 970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG No data
970226267_970226271 23 Left 970226267 4:13860468-13860490 CCGGATCATAGTCCTTTATATTC No data
Right 970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970226271 Original CRISPR AATCACACCCTGCTGCTTAC AGG Intergenic
No off target data available for this crispr