ID: 970229723

View in Genome Browser
Species Human (GRCh38)
Location 4:13897339-13897361
Sequence AAGCAAGCCAAGAGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970229718_970229723 22 Left 970229718 4:13897294-13897316 CCAACCAGCTGCTCATCTTTGAG No data
Right 970229723 4:13897339-13897361 AAGCAAGCCAAGAGGAGCAAAGG No data
970229719_970229723 18 Left 970229719 4:13897298-13897320 CCAGCTGCTCATCTTTGAGAGAG No data
Right 970229723 4:13897339-13897361 AAGCAAGCCAAGAGGAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970229723 Original CRISPR AAGCAAGCCAAGAGGAGCAA AGG Intergenic
No off target data available for this crispr