ID: 970229860 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:13898542-13898564 |
Sequence | CATAAACTGGACAAACTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970229860_970229865 | 1 | Left | 970229860 | 4:13898542-13898564 | CCATCCAGTTTGTCCAGTTTATG | No data | ||
Right | 970229865 | 4:13898566-13898588 | CACTTTGTTATGGCAGCCCTAGG | 0: 12 1: 104 2: 386 3: 812 4: 1417 |
||||
970229860_970229866 | 14 | Left | 970229860 | 4:13898542-13898564 | CCATCCAGTTTGTCCAGTTTATG | No data | ||
Right | 970229866 | 4:13898579-13898601 | CAGCCCTAGGAAACTAATACAGG | 0: 11 1: 68 2: 179 3: 426 4: 1249 |
||||
970229860_970229864 | -9 | Left | 970229860 | 4:13898542-13898564 | CCATCCAGTTTGTCCAGTTTATG | No data | ||
Right | 970229864 | 4:13898556-13898578 | CAGTTTATGGCACTTTGTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970229860 | Original CRISPR | CATAAACTGGACAAACTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |