ID: 970229860

View in Genome Browser
Species Human (GRCh38)
Location 4:13898542-13898564
Sequence CATAAACTGGACAAACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970229860_970229865 1 Left 970229860 4:13898542-13898564 CCATCCAGTTTGTCCAGTTTATG No data
Right 970229865 4:13898566-13898588 CACTTTGTTATGGCAGCCCTAGG 0: 12
1: 104
2: 386
3: 812
4: 1417
970229860_970229866 14 Left 970229860 4:13898542-13898564 CCATCCAGTTTGTCCAGTTTATG No data
Right 970229866 4:13898579-13898601 CAGCCCTAGGAAACTAATACAGG 0: 11
1: 68
2: 179
3: 426
4: 1249
970229860_970229864 -9 Left 970229860 4:13898542-13898564 CCATCCAGTTTGTCCAGTTTATG No data
Right 970229864 4:13898556-13898578 CAGTTTATGGCACTTTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970229860 Original CRISPR CATAAACTGGACAAACTGGA TGG (reversed) Intergenic
No off target data available for this crispr