ID: 970233499

View in Genome Browser
Species Human (GRCh38)
Location 4:13934461-13934483
Sequence ACCTGTGTGGAGCCCTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970233496_970233499 -8 Left 970233496 4:13934446-13934468 CCATGGCACACGTTTACCTGTGT 0: 86
1: 843
2: 2695
3: 6281
4: 7135
Right 970233499 4:13934461-13934483 ACCTGTGTGGAGCCCTCACTGGG No data
970233493_970233499 25 Left 970233493 4:13934413-13934435 CCTAGGTGACGGGTTGATAGGTG 0: 46
1: 1204
2: 2561
3: 2514
4: 2257
Right 970233499 4:13934461-13934483 ACCTGTGTGGAGCCCTCACTGGG No data
970233495_970233499 -5 Left 970233495 4:13934443-13934465 CCACCATGGCACACGTTTACCTG 0: 80
1: 831
2: 2641
3: 6329
4: 9344
Right 970233499 4:13934461-13934483 ACCTGTGTGGAGCCCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970233499 Original CRISPR ACCTGTGTGGAGCCCTCACT GGG Intergenic
No off target data available for this crispr