ID: 970234421

View in Genome Browser
Species Human (GRCh38)
Location 4:13944383-13944405
Sequence TCTGCCAGTCAGTGACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970234421_970234429 19 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234429 4:13944425-13944447 GGGCAGTTGGAGGAGAGCCCGGG 0: 15
1: 48
2: 93
3: 130
4: 477
970234421_970234428 18 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234428 4:13944424-13944446 GGGGCAGTTGGAGGAGAGCCCGG 0: 11
1: 42
2: 62
3: 155
4: 739
970234421_970234423 -3 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234423 4:13944403-13944425 AGAACGACACAGAGTTTGGCTGG No data
970234421_970234426 6 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234426 4:13944412-13944434 CAGAGTTTGGCTGGGGCAGTTGG No data
970234421_970234422 -7 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234422 4:13944399-13944421 TGGCAGAACGACACAGAGTTTGG No data
970234421_970234424 -2 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234424 4:13944404-13944426 GAACGACACAGAGTTTGGCTGGG No data
970234421_970234425 -1 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234425 4:13944405-13944427 AACGACACAGAGTTTGGCTGGGG No data
970234421_970234427 9 Left 970234421 4:13944383-13944405 CCGGCAGGTCACTGACTGGCAGA No data
Right 970234427 4:13944415-13944437 AGTTTGGCTGGGGCAGTTGGAGG 0: 24
1: 55
2: 83
3: 130
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970234421 Original CRISPR TCTGCCAGTCAGTGACCTGC CGG (reversed) Intergenic
No off target data available for this crispr