ID: 970235970

View in Genome Browser
Species Human (GRCh38)
Location 4:13958248-13958270
Sequence GTTTCACGGGACTGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970235963_970235970 20 Left 970235963 4:13958205-13958227 CCAGTCTAAAGTGTATGAACTTT No data
Right 970235970 4:13958248-13958270 GTTTCACGGGACTGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970235970 Original CRISPR GTTTCACGGGACTGGGATGA GGG Intergenic
No off target data available for this crispr