ID: 970243704

View in Genome Browser
Species Human (GRCh38)
Location 4:14036056-14036078
Sequence CAGTGTCCAGAAAGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970243704_970243711 14 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243711 4:14036093-14036115 CCCGGTTCTGGGAAAATATGAGG No data
970243704_970243706 -10 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243706 4:14036069-14036091 CTGGACACTGAAAGATGAGAAGG No data
970243704_970243708 2 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243708 4:14036081-14036103 AGATGAGAAGGACCCGGTTCTGG No data
970243704_970243713 15 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243713 4:14036094-14036116 CCGGTTCTGGGAAAATATGAGGG No data
970243704_970243707 -4 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243707 4:14036075-14036097 ACTGAAAGATGAGAAGGACCCGG No data
970243704_970243709 3 Left 970243704 4:14036056-14036078 CCACCTTCTCTTTCTGGACACTG No data
Right 970243709 4:14036082-14036104 GATGAGAAGGACCCGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970243704 Original CRISPR CAGTGTCCAGAAAGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr