ID: 970248869

View in Genome Browser
Species Human (GRCh38)
Location 4:14093239-14093261
Sequence GGGTGGAAGAGGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970248859_970248869 0 Left 970248859 4:14093216-14093238 CCCCCTCAACCAGCTTAGAAGTC No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248860_970248869 -1 Left 970248860 4:14093217-14093239 CCCCTCAACCAGCTTAGAAGTCG No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248863_970248869 -3 Left 970248863 4:14093219-14093241 CCTCAACCAGCTTAGAAGTCGGG No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248857_970248869 4 Left 970248857 4:14093212-14093234 CCCTCCCCCTCAACCAGCTTAGA No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248856_970248869 14 Left 970248856 4:14093202-14093224 CCTGCAGACTCCCTCCCCCTCAA No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248866_970248869 -9 Left 970248866 4:14093225-14093247 CCAGCTTAGAAGTCGGGTGGAAG No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248858_970248869 3 Left 970248858 4:14093213-14093235 CCTCCCCCTCAACCAGCTTAGAA No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data
970248861_970248869 -2 Left 970248861 4:14093218-14093240 CCCTCAACCAGCTTAGAAGTCGG No data
Right 970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970248869 Original CRISPR GGGTGGAAGAGGAAGCTGGA TGG Intergenic
No off target data available for this crispr