ID: 970252311

View in Genome Browser
Species Human (GRCh38)
Location 4:14128804-14128826
Sequence TTGAAAGAACAGAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970252306_970252311 7 Left 970252306 4:14128774-14128796 CCAATCTCCAAGTGAGAGAAGTG No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data
970252303_970252311 14 Left 970252303 4:14128767-14128789 CCTCCACCCAATCTCCAAGTGAG No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data
970252302_970252311 15 Left 970252302 4:14128766-14128788 CCCTCCACCCAATCTCCAAGTGA No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data
970252305_970252311 8 Left 970252305 4:14128773-14128795 CCCAATCTCCAAGTGAGAGAAGT No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data
970252308_970252311 0 Left 970252308 4:14128781-14128803 CCAAGTGAGAGAAGTGGATATGA No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data
970252304_970252311 11 Left 970252304 4:14128770-14128792 CCACCCAATCTCCAAGTGAGAGA No data
Right 970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970252311 Original CRISPR TTGAAAGAACAGAGGCAGAA GGG Intergenic
No off target data available for this crispr