ID: 970258457

View in Genome Browser
Species Human (GRCh38)
Location 4:14196445-14196467
Sequence GTTTCAATGAAGAAAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970258457_970258462 27 Left 970258457 4:14196445-14196467 CCCCCAGCTTTCTTCATTGAAAC No data
Right 970258462 4:14196495-14196517 TATCAATTTAACTGCCCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970258457 Original CRISPR GTTTCAATGAAGAAAGCTGG GGG (reversed) Intergenic
No off target data available for this crispr