ID: 970264575

View in Genome Browser
Species Human (GRCh38)
Location 4:14267235-14267257
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970264575_970264577 9 Left 970264575 4:14267235-14267257 CCAGTGGAGACTGGCCGGAATAC No data
Right 970264577 4:14267267-14267289 TTGATTAAGATACCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970264575 Original CRISPR GTATTCCGGCCAGTCTCCAC TGG (reversed) Intergenic
No off target data available for this crispr