ID: 970267775

View in Genome Browser
Species Human (GRCh38)
Location 4:14308047-14308069
Sequence TGGTAAATGAGAAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970267775_970267778 19 Left 970267775 4:14308047-14308069 CCTTCTTCCTTTCTCATTTACCA No data
Right 970267778 4:14308089-14308111 AACATAAATAAATATCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970267775 Original CRISPR TGGTAAATGAGAAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr