ID: 970270901

View in Genome Browser
Species Human (GRCh38)
Location 4:14346300-14346322
Sequence TGGCATAGCCCTAATGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970270901_970270904 11 Left 970270901 4:14346300-14346322 CCTACACCATTAGGGCTATGCCA No data
Right 970270904 4:14346334-14346356 ATCCTGACTCCCTTTGCACATGG No data
970270901_970270905 12 Left 970270901 4:14346300-14346322 CCTACACCATTAGGGCTATGCCA No data
Right 970270905 4:14346335-14346357 TCCTGACTCCCTTTGCACATGGG No data
970270901_970270907 16 Left 970270901 4:14346300-14346322 CCTACACCATTAGGGCTATGCCA No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970270901 Original CRISPR TGGCATAGCCCTAATGGTGT AGG (reversed) Intergenic
No off target data available for this crispr