ID: 970270907

View in Genome Browser
Species Human (GRCh38)
Location 4:14346339-14346361
Sequence GACTCCCTTTGCACATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970270896_970270907 28 Left 970270896 4:14346288-14346310 CCGTCCCATCTTCCTACACCATT No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data
970270901_970270907 16 Left 970270901 4:14346300-14346322 CCTACACCATTAGGGCTATGCCA No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data
970270898_970270907 24 Left 970270898 4:14346292-14346314 CCCATCTTCCTACACCATTAGGG No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data
970270900_970270907 23 Left 970270900 4:14346293-14346315 CCATCTTCCTACACCATTAGGGC No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data
970270902_970270907 10 Left 970270902 4:14346306-14346328 CCATTAGGGCTATGCCATGACTT No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data
970270903_970270907 -4 Left 970270903 4:14346320-14346342 CCATGACTTACTCTATCCTGACT No data
Right 970270907 4:14346339-14346361 GACTCCCTTTGCACATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970270907 Original CRISPR GACTCCCTTTGCACATGGGC TGG Intergenic
No off target data available for this crispr