ID: 970274619

View in Genome Browser
Species Human (GRCh38)
Location 4:14385141-14385163
Sequence TGGGAGAAGAAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970274619_970274623 -10 Left 970274619 4:14385141-14385163 CCCTCCTCCTTTTTCTTCTCCCA No data
Right 970274623 4:14385154-14385176 TCTTCTCCCAGAGTGTTATGTGG No data
970274619_970274624 -9 Left 970274619 4:14385141-14385163 CCCTCCTCCTTTTTCTTCTCCCA No data
Right 970274624 4:14385155-14385177 CTTCTCCCAGAGTGTTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970274619 Original CRISPR TGGGAGAAGAAAAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr