ID: 970277531

View in Genome Browser
Species Human (GRCh38)
Location 4:14417897-14417919
Sequence GAAGTATCTCTAATTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970277531_970277532 -2 Left 970277531 4:14417897-14417919 CCAATGGCAATTAGAGATACTTC No data
Right 970277532 4:14417918-14417940 TCAGAATGTTATTTTTTTTTTGG No data
970277531_970277534 23 Left 970277531 4:14417897-14417919 CCAATGGCAATTAGAGATACTTC No data
Right 970277534 4:14417943-14417965 TCAATTTATTTATCTTTCATAGG No data
970277531_970277533 -1 Left 970277531 4:14417897-14417919 CCAATGGCAATTAGAGATACTTC No data
Right 970277533 4:14417919-14417941 CAGAATGTTATTTTTTTTTTGGG No data
970277531_970277535 24 Left 970277531 4:14417897-14417919 CCAATGGCAATTAGAGATACTTC No data
Right 970277535 4:14417944-14417966 CAATTTATTTATCTTTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970277531 Original CRISPR GAAGTATCTCTAATTGCCAT TGG (reversed) Intergenic
No off target data available for this crispr