ID: 970281902

View in Genome Browser
Species Human (GRCh38)
Location 4:14465853-14465875
Sequence AGAGTGGGTCTGCTAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970281902_970281905 2 Left 970281902 4:14465853-14465875 CCGTCTGCTAGCAGACCCACTCT No data
Right 970281905 4:14465878-14465900 AGTCTCTCTCTGTCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970281902 Original CRISPR AGAGTGGGTCTGCTAGCAGA CGG (reversed) Intergenic