ID: 970283938

View in Genome Browser
Species Human (GRCh38)
Location 4:14488154-14488176
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970283938_970283942 -6 Left 970283938 4:14488154-14488176 CCAACCCTATTGACATTATTCCA No data
Right 970283942 4:14488171-14488193 ATTCCACAGGATAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970283938 Original CRISPR TGGAATAATGTCAATAGGGT TGG (reversed) Intergenic
No off target data available for this crispr