ID: 970288859

View in Genome Browser
Species Human (GRCh38)
Location 4:14549958-14549980
Sequence CACGTTAATCCCCTTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970288854_970288859 3 Left 970288854 4:14549932-14549954 CCCTCCCTATCCTTCATTTCTCT No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288857_970288859 -2 Left 970288857 4:14549937-14549959 CCTATCCTTCATTTCTCTGCTCA No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288851_970288859 14 Left 970288851 4:14549921-14549943 CCTTTCCCAGGCCCTCCCTATCC No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288852_970288859 9 Left 970288852 4:14549926-14549948 CCCAGGCCCTCCCTATCCTTCAT No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288855_970288859 2 Left 970288855 4:14549933-14549955 CCTCCCTATCCTTCATTTCTCTG No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288853_970288859 8 Left 970288853 4:14549927-14549949 CCAGGCCCTCCCTATCCTTCATT No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288858_970288859 -7 Left 970288858 4:14549942-14549964 CCTTCATTTCTCTGCTCACGTTA No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data
970288856_970288859 -1 Left 970288856 4:14549936-14549958 CCCTATCCTTCATTTCTCTGCTC No data
Right 970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970288859 Original CRISPR CACGTTAATCCCCTTCAGAG AGG Intergenic
No off target data available for this crispr