ID: 970290835

View in Genome Browser
Species Human (GRCh38)
Location 4:14570490-14570512
Sequence ATGCATGTTTATATGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970290829_970290835 13 Left 970290829 4:14570454-14570476 CCACAAGGTCATCTTCAAAACAT No data
Right 970290835 4:14570490-14570512 ATGCATGTTTATATGGCACCAGG No data
970290830_970290835 -10 Left 970290830 4:14570477-14570499 CCCTTTTATCCCTATGCATGTTT No data
Right 970290835 4:14570490-14570512 ATGCATGTTTATATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970290835 Original CRISPR ATGCATGTTTATATGGCACC AGG Intergenic
No off target data available for this crispr