ID: 970291849

View in Genome Browser
Species Human (GRCh38)
Location 4:14581647-14581669
Sequence AACAGCCATTTGGACAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970291849_970291852 18 Left 970291849 4:14581647-14581669 CCAAATTTGTCCAAATGGCTGTT No data
Right 970291852 4:14581688-14581710 CAAAACAGTGACACTAAAGAGGG No data
970291849_970291851 17 Left 970291849 4:14581647-14581669 CCAAATTTGTCCAAATGGCTGTT No data
Right 970291851 4:14581687-14581709 GCAAAACAGTGACACTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970291849 Original CRISPR AACAGCCATTTGGACAAATT TGG (reversed) Intergenic
No off target data available for this crispr