ID: 970296723

View in Genome Browser
Species Human (GRCh38)
Location 4:14638778-14638800
Sequence AATCTTCAGGGACCCTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970296718_970296723 26 Left 970296718 4:14638729-14638751 CCTGGAATTACCAGCAGAACATT No data
Right 970296723 4:14638778-14638800 AATCTTCAGGGACCCTGAAAGGG No data
970296719_970296723 16 Left 970296719 4:14638739-14638761 CCAGCAGAACATTTTACTAATCA No data
Right 970296723 4:14638778-14638800 AATCTTCAGGGACCCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970296723 Original CRISPR AATCTTCAGGGACCCTGAAA GGG Intergenic
No off target data available for this crispr