ID: 970301791

View in Genome Browser
Species Human (GRCh38)
Location 4:14689067-14689089
Sequence CTGCAGATACAGATGTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970301791_970301793 -4 Left 970301791 4:14689067-14689089 CCTATGTACATCTGTATCTGCAG No data
Right 970301793 4:14689086-14689108 GCAGAACAAGGTCTCCTCAGAGG No data
970301791_970301796 14 Left 970301791 4:14689067-14689089 CCTATGTACATCTGTATCTGCAG No data
Right 970301796 4:14689104-14689126 AGAGGAGCACATCTTTGGAATGG No data
970301791_970301794 9 Left 970301791 4:14689067-14689089 CCTATGTACATCTGTATCTGCAG No data
Right 970301794 4:14689099-14689121 TCCTCAGAGGAGCACATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970301791 Original CRISPR CTGCAGATACAGATGTACAT AGG (reversed) Intergenic
No off target data available for this crispr