ID: 970304523

View in Genome Browser
Species Human (GRCh38)
Location 4:14717988-14718010
Sequence ATGCAGAAACAGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970304523_970304528 14 Left 970304523 4:14717988-14718010 CCGTGCCCAGCCTGTTTCTGCAT No data
Right 970304528 4:14718025-14718047 CCCAACCCTCTCTCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970304523 Original CRISPR ATGCAGAAACAGGCTGGGCA CGG (reversed) Intergenic
No off target data available for this crispr