ID: 970309676

View in Genome Browser
Species Human (GRCh38)
Location 4:14768855-14768877
Sequence CATTTGTAGCAGATGCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970309676_970309680 29 Left 970309676 4:14768855-14768877 CCCCGCAGCATCTGCTACAAATG No data
Right 970309680 4:14768907-14768929 CTAGACTAGGAATATGACCCTGG No data
970309676_970309679 16 Left 970309676 4:14768855-14768877 CCCCGCAGCATCTGCTACAAATG No data
Right 970309679 4:14768894-14768916 ATTTAAGCAGAAGCTAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970309676 Original CRISPR CATTTGTAGCAGATGCTGCG GGG (reversed) Intergenic
No off target data available for this crispr