ID: 970313197

View in Genome Browser
Species Human (GRCh38)
Location 4:14804390-14804412
Sequence CTGATTGTAAAGAGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970313192_970313197 18 Left 970313192 4:14804349-14804371 CCTACTGGTTGTCCATAAAGGAC No data
Right 970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG No data
970313191_970313197 19 Left 970313191 4:14804348-14804370 CCCTACTGGTTGTCCATAAAGGA No data
Right 970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG No data
970313193_970313197 6 Left 970313193 4:14804361-14804383 CCATAAAGGACAATTTTTGAATT No data
Right 970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970313197 Original CRISPR CTGATTGTAAAGAGGGCAAA AGG Intergenic
No off target data available for this crispr